From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_002025
  • pan locus tag?: SAUPAN005333000
  • symbol: sigB
  • pan gene symbol?: sigB
  • synonym:
  • product: RNA polymerase sigma factor SigB

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_002025
  • symbol: sigB
  • product: RNA polymerase sigma factor SigB
  • replicon: chromosome
  • strand: -
  • coordinates: 2041497..2042267
  • length: 771
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCGAAAGAGTCGAAATCAGCTAATGAAGTTTCACCTGAGCAAATTAACCAATGGATT
    AAAGAACACCAAGAAAATAAGAATACAGATGCACAGGATAAGTTAGTTAAACATTACCAA
    AAACTAATTGAGTCATTGGCATATAAATATTCTAAAGGACAATCACATCACGAAGATTTA
    GTTCAAGTTGGTATGGTTGGTTTAATAGGTGCCATAAATAGATTCGATATGTCCTTTGAA
    CGGAAGTTTGAAGCCTTTTTAGTACCTACTGTAATCGGTGAAATCAAAAGATATCTACGA
    GATAAAACTTGGAGTGTACATGTTCCGAGACGTATTAAAGAAATTGGGCCAAGAATCAAA
    AAAGTGAGCGATGAACTAACCGCTGAATTAGAGCGTTCACCTTCTATCAGTGAAATAGCT
    GATCGATTAGAAGTTTCAGAAGAAGAAGTGTTAGAAGCAATGGAAATGGGACAAAGTTAT
    AATGCGTTAAGTGTTGATCATTCCATTGAAGCTGATAAAGATGGTTCAACTGTTACGCTA
    TTAGATATTATGGGACAACAAGATGACCATTATGACTTAACTGAAAAACGTATGATTTTA
    GAAAAAATATTACCTATATTATCTGATCGCGAACGAGAAATCATACAATGTACGTTTATT
    GAAGGTTTGAGTCAAAAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCA
    CGACTTCAAAGAACGGCAATTAAGAAATTACAAGAAGCAGCACATAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    771

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_002025
  • symbol: SigB
  • description: RNA polymerase sigma factor SigB
  • length: 256
  • theoretical pI: 5.85963
  • theoretical MW: 29429.3
  • GRAVY: -0.61875

Function[edit | edit source]

  • TIGRFAM:
    RNA polymerase sigma-B factor (TIGR02941; HMM-score: 486.3)
    and 30 more
    RNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 303.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 138.1)
    RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 119.7)
    RNA polymerase sigma factor, cyanobacterial RpoD-like family (TIGR02997; HMM-score: 92.6)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoD (TIGR02393; HMM-score: 81.4)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)
    Cellular processes Cellular processes Adaptations to atypical conditions alternative sigma factor RpoH (TIGR02392; HMM-score: 67.5)
    Genetic information processing Transcription Transcription factors alternative sigma factor RpoH (TIGR02392; HMM-score: 67.5)
    Cellular processes Cellular processes Adaptations to atypical conditions RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.5)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.5)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63.1)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63.1)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 46.9)
    RNA polymerase sigma-70 factor, Planctomycetaceae-specific subfamily 1 (TIGR02984; HMM-score: 35.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35)
    RNA polymerase sigma-70 factor, TIGR02952 family (TIGR02952; HMM-score: 34)
    RNA polymerase sigma factor, SigZ family (TIGR02959; HMM-score: 26)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 23.2)
    RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 21.2)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)
    RNA polymerase sigma-70 factor, Rhodopirellula/Verrucomicrobium family (TIGR02989; HMM-score: 18.8)
    RNA polymerase sigma-70 factor, Myxococcales family 1 (TIGR03001; HMM-score: 16.2)
    RNA polymerase sigma factor RpoE (TIGR02939; HMM-score: 13.7)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    HTH (CL0123) Sigma70_r3; Sigma-70 region 3 (PF04539; HMM-score: 67)
    Sigma70_r2; Sigma-70 region 2 (PF04542; HMM-score: 66.6)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 64)
    and 16 more
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 25)
    Sigma70_ECF; ECF sigma factor (PF07638; HMM-score: 23.4)
    GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 21.5)
    HTH_Tnp_1; Transposase (PF01527; HMM-score: 19.3)
    HTH_16; Helix-turn-helix domain (PF12645; HMM-score: 18.5)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 17.3)
    HTH_3; Helix-turn-helix (PF01381; HMM-score: 17.2)
    KORA; TrfB plasmid transcriptional repressor (PF16509; HMM-score: 16.8)
    IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 15.3)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 15.3)
    HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 14.7)
    HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 14.5)
    no clan defined DUF6761; Family of unknown function (DUF6761) (PF20547; HMM-score: 13.3)
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 12.9)
    NirdL-like_HTH; Siroheme decarboxylase NirDL-like HTH domain (PF22451; HMM-score: 12.6)
    PhyR_sigma-like; Response regulator PhyR, sigma-like domain (PF22233; HMM-score: 12.3)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9906
    • Cytoplasmic Membrane Score: 0.0085
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0008
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007805
    • TAT(Tat/SPI): 0.00056
    • LIPO(Sec/SPII): 0.000709
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MAKESKSANEVSPEQINQWIKEHQENKNTDAQDKLVKHYQKLIESLAYKYSKGQSHHEDLVQVGMVGLIGAINRFDMSFERKFEAFLVPTVIGEIKRYLRDKTWSVHVPRRIKEIGPRIKKVSDELTAELERSPSISEIADRLEVSEEEVLEAMEMGQSYNALSVDHSIEADKDGSTVTLLDIMGQQDDHYDLTEKRMILEKILPILSDREREIIQCTFIEGLSQKETGERIGLSQMHVSRLQRTAIKKLQEAAHK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB (activation) regulon
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  [1] [2] [3]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  2. 2.0 2.1 Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int J Med Microbiol: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  3. 3.0 3.1 Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J Bacteriol: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)
  4. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]