From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_000436
  • pan locus tag?: SAUPAN002235000
  • symbol: JSNZ_000436
  • pan gene symbol?: yabJ
  • synonym:
  • product: RidA family protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_000436
  • symbol: JSNZ_000436
  • product: RidA family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 467918..468298
  • length: 381
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAAAATCATTAACACAACAAGATTACCGGAAGCACTTGGACCATATTCGCATGCAACA
    GTTGTGAATGGTATGGTTTATACTTCTGGTCAGATTCCATTGAATATTGATGGACATATC
    GTAAGCGCTGATGTTCAAGCACAGACAAAACAAGTTTTAGAAAATTTAAAGGTTGTTTTG
    GAAGAAGCAGGATCTGATTTGAATTCTGTTGCGAAAGCGACCATTTTCATTAAAGATATG
    AATGATTTCCAAAAAATAAATGAAGTGTATGGTCAATATTTTAATGAACACAAGCCAGCG
    CGTAGTTGTGTAGAGGTTGCGCGTTTGCCAAAAGATGTGAAAGTAGAAATTGAATTAGTA
    AGTAAAATTAAGGAATTATAA
    60
    120
    180
    240
    300
    360
    381

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_000436
  • symbol: JSNZ_000436
  • description: RidA family protein
  • length: 126
  • theoretical pI: 6.25457
  • theoretical MW: 13996
  • GRAVY: -0.139683

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Other reactive intermediate/imine deaminase (TIGR00004; HMM-score: 169.2)
    and 2 more
    pyrimidine utilization protein C (TIGR03610; HMM-score: 99)
    amanitin/phalloidin family toxin (TIGR04309; HMM-score: 11.8)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    YjgF-like (CL0534) Ribonuc_L-PSP; Endoribonuclease L-PSP (PF01042; HMM-score: 150.7)
    and 4 more
    no clan defined Cap15_CD_rec; Cap15, cyclic dinucleotide receptor domain (PF18153; HMM-score: 13.4)
    Eclosion; Eclosion hormone (PF04736; HMM-score: 12.8)
    DUF6164; Family of unknown function (DUF6164) (PF19661; HMM-score: 12.7)
    Rab3-GTPase_cat; Rab3 GTPase-activating protein catalytic subunit (PF13890; HMM-score: 11.4)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9765
    • Cytoplasmic Membrane Score: 0.0004
    • Cell wall & surface Score: 0.001
    • Extracellular Score: 0.0222
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.03533
    • TAT(Tat/SPI): 0.001711
    • LIPO(Sec/SPII): 0.004131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MKIINTTRLPEALGPYSHATVVNGMVYTSGQIPLNIDGHIVSADVQAQTKQVLENLKVVLEEAGSDLNSVAKATIFIKDMNDFQKINEVYGQYFNEHKPARSCVEVARLPKDVKVEIELVSKIKEL

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB (activation) regulon
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026)   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]