Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_000436
- pan locus tag?: SAUPAN002235000
- symbol: JSNZ_000436
- pan gene symbol?: yabJ
- synonym:
- product: RidA family protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_000436
- symbol: JSNZ_000436
- product: RidA family protein
- replicon: chromosome
- strand: +
- coordinates: 467918..468298
- length: 381
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGAAAATCATTAACACAACAAGATTACCGGAAGCACTTGGACCATATTCGCATGCAACA
GTTGTGAATGGTATGGTTTATACTTCTGGTCAGATTCCATTGAATATTGATGGACATATC
GTAAGCGCTGATGTTCAAGCACAGACAAAACAAGTTTTAGAAAATTTAAAGGTTGTTTTG
GAAGAAGCAGGATCTGATTTGAATTCTGTTGCGAAAGCGACCATTTTCATTAAAGATATG
AATGATTTCCAAAAAATAAATGAAGTGTATGGTCAATATTTTAATGAACACAAGCCAGCG
CGTAGTTGTGTAGAGGTTGCGCGTTTGCCAAAAGATGTGAAAGTAGAAATTGAATTAGTA
AGTAAAATTAAGGAATTATAA60
120
180
240
300
360
381
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_000436
- symbol: JSNZ_000436
- description: RidA family protein
- length: 126
- theoretical pI: 6.25457
- theoretical MW: 13996
- GRAVY: -0.139683
⊟Function[edit | edit source]
- TIGRFAM: Cellular processes Other reactive intermediate/imine deaminase (TIGR00004; HMM-score: 169.2)and 2 morepyrimidine utilization protein C (TIGR03610; HMM-score: 99)amanitin/phalloidin family toxin (TIGR04309; HMM-score: 11.8)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: YjgF-like (CL0534) Ribonuc_L-PSP; Endoribonuclease L-PSP (PF01042; HMM-score: 150.7)and 4 moreno clan defined Cap15_CD_rec; Cap15, cyclic dinucleotide receptor domain (PF18153; HMM-score: 13.4)Eclosion; Eclosion hormone (PF04736; HMM-score: 12.8)DUF6164; Family of unknown function (DUF6164) (PF19661; HMM-score: 12.7)Rab3-GTPase_cat; Rab3 GTPase-activating protein catalytic subunit (PF13890; HMM-score: 11.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9765
- Cytoplasmic Membrane Score: 0.0004
- Cell wall & surface Score: 0.001
- Extracellular Score: 0.0222
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.03533
- TAT(Tat/SPI): 0.001711
- LIPO(Sec/SPII): 0.004131
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MKIINTTRLPEALGPYSHATVVNGMVYTSGQIPLNIDGHIVSADVQAQTKQVLENLKVVLEEAGSDLNSVAKATIFIKDMNDFQKINEVYGQYFNEHKPARSCVEVARLPKDVKVEIELVSKIKEL
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : ispE > purR > JSNZ_000436 > spoVG
⊟Regulation[edit | edit source]
- regulator: SigB (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p) - ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
J Bacteriol: 2004, 186(13);4085-99
[PubMed:15205410] [WorldCat.org] [DOI] (P p) - ↑ Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
The sigmaB regulon in Staphylococcus aureus and its regulation.
Int J Med Microbiol: 2006, 296(4-5);237-58
[PubMed:16644280] [WorldCat.org] [DOI] (P p) - ↑ Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
J Bacteriol: 2011, 193(18);4954-62
[PubMed:21725011] [WorldCat.org] [DOI] (I p)