Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0540 [new locus tag: SACOL_RS02760 ]
- pan locus tag?: SAUPAN002235000
- symbol: SACOL0540
- pan gene symbol?: yabJ
- synonym:
- product: endoribonuclease L-PSP
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0540 [new locus tag: SACOL_RS02760 ]
- symbol: SACOL0540
- product: endoribonuclease L-PSP
- replicon: chromosome
- strand: +
- coordinates: 548804..549184
- length: 381
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238252 NCBI
- RefSeq: YP_185428 NCBI
- BioCyc: see SACOL_RS02760
- MicrobesOnline: 912012 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGAAAATCATTAACACAACAAGATTACCGGAAGCACTTGGACCATATTCGCATGCAACA
GTTGTGAATGGTATGGTTTATACTTCTGGTCAGATTCCATTGAATATTGATGGACATATC
GTAAGCGCTGATGTTCAAGCACAGACAAAACAAGTTTTAGAAAATTTAAAGGTTGTTTTG
GAAGAAGCAGGATCTGATTTGAATTCTGTTGCGAAAGCGACCATTTTCATTAAAGATATG
AATGATTTCCAAAAAATAAATGAAGTGTATGGTCAATATTTTAATGAACACAAGCCAGCG
CGTAGTTGTGTAGAGGTTGCGCGTTTGCCAAAAGATGTGAAAGTAGAAATTGAATTAGTA
AGTAAAATTAAGGAATTATAA60
120
180
240
300
360
381
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0540 [new locus tag: SACOL_RS02760 ]
- symbol: SACOL0540
- description: endoribonuclease L-PSP
- length: 126
- theoretical pI: 6.25457
- theoretical MW: 13996
- GRAVY: -0.139683
⊟Function[edit | edit source]
- TIGRFAM: Cellular processes Other reactive intermediate/imine deaminase (TIGR00004; HMM-score: 169.2)and 2 morepyrimidine utilization protein C (TIGR03610; HMM-score: 99)amanitin/phalloidin family toxin (TIGR04309; HMM-score: 11.8)
- TheSEED :
- RidA/YER057c/UK114 superfamily protein
- PFAM: YjgF-like (CL0534) Ribonuc_L-PSP; Endoribonuclease L-PSP (PF01042; HMM-score: 150.7)and 4 moreno clan defined Cap15_CD_rec; Cap15, cyclic dinucleotide receptor domain (PF18153; HMM-score: 13.4)Eclosion; Eclosion hormone (PF04736; HMM-score: 12.8)DUF6164; Family of unknown function (DUF6164) (PF19661; HMM-score: 12.7)Rab3-GTPase_cat; Rab3 GTPase-activating protein catalytic subunit (PF13890; HMM-score: 11.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9765
- Cytoplasmic Membrane Score: 0.0004
- Cell wall & surface Score: 0.001
- Extracellular Score: 0.0222
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.03533
- TAT(Tat/SPI): 0.001711
- LIPO(Sec/SPII): 0.004131
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKIINTTRLPEALGPYSHATVVNGMVYTSGQIPLNIDGHIVSADVQAQTKQVLENLKVVLEEAGSDLNSVAKATIFIKDMNDFQKINEVYGQYFNEHKPARSCVEVARLPKDVKVEIELVSKIKEL
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2]
- quantitative data / protein copy number per cell: 143 [3]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: ipk > purR > SACOL0540
⊟Regulation[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: 20.35 h [5]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
J Bacteriol: 2004, 186(13);4085-99
[PubMed:15205410] [WorldCat.org] [DOI] (P p) - ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)