From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1869 [new locus tag: SA_RS10750 ]
  • pan locus tag?: SAUPAN005333000
  • symbol: sigB
  • pan gene symbol?: sigB
  • synonym:
  • product: RNA polymerase sigma factor SigB

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SA1869 [new locus tag: SA_RS10750 ]
  • symbol: sigB
  • product: RNA polymerase sigma factor SigB
  • replicon: chromosome
  • strand: -
  • coordinates: 2118150..2118920
  • length: 771
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCGAAAGAGTCGAAATCAGCTAATGAAGTTTCACCTGAGCAAATTAACCAATGGATT
    AAAGAACACCAAGAAAATAAGAATACAGATGCACAGGATAAGTTAGTTAAACATTACCAA
    AAACTAATTGAGTCATTGGCATATAAATATTCTAAAGGACAATCACATCACGAAGATTTA
    GTTCAAGTTGGTATGGTTGGTTTAATAGGTGCCATAAATAGATTCGATATGTCCTTTGAA
    CGGAAGTTTGAAGCCTTTTTAGTACCTACTGTAATCGGTGAAATCAAAAGATATCTACGA
    GATAAAACTTGGAGTGTACATGTTCCGAGACGTATTAAAGAAATTGGGCCAAGAATCAAA
    AAAGTGAGCGATGAACTAACCGCTGAATTAGAGCGTTCACCTTCTATCAGTGAAATAGCT
    AATCGATTAGAAGTCTCAGAAGAAGAAGTGTTAGAAGCAATGGAAATGGGACAAAGTTAT
    AATGCGTTAAGTGTTGATCATTCCATTGAAGCTGATAAAGATGGTTCAACTGTTACGCTA
    TTAGATATTATGGGGCAACAAGATGACCATTATGACTTAACTGAAAAACGTATGATTTTA
    GAAAAAATATTACCTATATTATCTGATCGCGAACGAGAAATCATACAATGTACGTTTATT
    GAAGGATTGAGTCAAAAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCA
    CGACTTCAGAGAACGGCAATTAAGAAATTACAAGAAGCAGCACATAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    771


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SA1869 [new locus tag: SA_RS10750 ]
  • symbol: SigB
  • description: RNA polymerase sigma factor SigB
  • length: 256
  • theoretical pI: 6.06399
  • theoretical MW: 29428.3
  • GRAVY: -0.61875

⊟Function[edit | edit source]

  • TIGRFAM:
    RNA polymerase sigma-B factor (TIGR02941; HMM-score: 486.4)
    and 30 more
    RNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 303.1)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.7)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.7)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 144.9)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 144.9)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 137.5)
    RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 120)
    RNA polymerase sigma factor, cyanobacterial RpoD-like family (TIGR02997; HMM-score: 92.6)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoD (TIGR02393; HMM-score: 81)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.7)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.7)
    Cellular processes Cellular processes Adaptations to atypical conditions alternative sigma factor RpoH (TIGR02392; HMM-score: 67.3)
    Genetic information processing Transcription Transcription factors alternative sigma factor RpoH (TIGR02392; HMM-score: 67.3)
    Cellular processes Cellular processes Adaptations to atypical conditions RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.7)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.7)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63.1)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63.1)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 46.1)
    RNA polymerase sigma-70 factor, Planctomycetaceae-specific subfamily 1 (TIGR02984; HMM-score: 36.2)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35)
    RNA polymerase sigma-70 factor, TIGR02952 family (TIGR02952; HMM-score: 34.2)
    RNA polymerase sigma factor, SigZ family (TIGR02959; HMM-score: 26.3)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 23.3)
    RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 21)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.8)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.8)
    RNA polymerase sigma-70 factor, Rhodopirellula/Verrucomicrobium family (TIGR02989; HMM-score: 18.8)
    RNA polymerase sigma-70 factor, Myxococcales family 1 (TIGR03001; HMM-score: 16.3)
    RNA polymerase sigma factor RpoE (TIGR02939; HMM-score: 13.7)
  • TheSEED  :
    • RNA polymerase sigma factor SigB
    Regulation and Cell signaling Quorum sensing and biofilm formation Biofilm formation in Staphylococcus  RNA polymerase sigma factor SigB
    and 2 more
    RNA Metabolism Transcription Transcription initiation, bacterial sigma factors  RNA polymerase sigma factor SigB
    Stress Response Stress Response - no subcategory SigmaB stress responce regulation  RNA polymerase sigma factor SigB
  • PFAM:
    HTH (CL0123) Sigma70_r3; Sigma-70 region 3 (PF04539; HMM-score: 67)
    Sigma70_r2; Sigma-70 region 2 (PF04542; HMM-score: 66.6)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 63.2)
    and 15 more
    Sigma70_ECF; ECF sigma factor (PF07638; HMM-score: 23.1)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 22.7)
    GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 20.2)
    HTH_Tnp_1; Transposase (PF01527; HMM-score: 19.7)
    HTH_16; Helix-turn-helix domain (PF12645; HMM-score: 18.6)
    HTH_3; Helix-turn-helix (PF01381; HMM-score: 17.1)
    KORA; TrfB plasmid transcriptional repressor (PF16509; HMM-score: 16.8)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 15.9)
    IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 15.5)
    HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 15.3)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 13.8)
    no clan defined DUF6761; Family of unknown function (DUF6761) (PF20547; HMM-score: 13.4)
    HTH (CL0123) HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 13)
    NirdL-like_HTH; Siroheme decarboxylase NirDL-like HTH domain (PF22451; HMM-score: 12.9)
    PhyR_sigma-like; Response regulator PhyR, sigma-like domain (PF22233; HMM-score: 12.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • genes regulated by SigB*, sigma factor controlling a large regulon involved in stress/starvation response and adaptation: in COL, JSNZ, NCTC8325, Newman

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9904
    • Cytoplasmic Membrane Score: 0.0087
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0009
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007805
    • TAT(Tat/SPI): 0.00056
    • LIPO(Sec/SPII): 0.000709
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MAKESKSANEVSPEQINQWIKEHQENKNTDAQDKLVKHYQKLIESLAYKYSKGQSHHEDLVQVGMVGLIGAINRFDMSFERKFEAFLVPTVIGEIKRYLRDKTWSVHVPRRIKEIGPRIKKVSDELTAELERSPSISEIANRLEVSEEEVLEAMEMGQSYNALSVDHSIEADKDGSTVTLLDIMGQQDDHYDLTEKRMILEKILPILSDREREIIQCTFIEGLSQKETGERIGLSQMHVSRLQRTAIKKLQEAAHK

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA0501(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA1930(rpoE)DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SA1870(rsbW)serine-protein kinase RsbW  [1] (data from MRSA252)
    SA0323hypothetical protein  [1] (data from MRSA252)
    SA0941hypothetical protein  [1] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Hong Zhang, Kazuya Morikawa, Toshiko Ohta, Yusuke Kato
In vitro resistance to the CSalphabeta-type antimicrobial peptide ASABF-alpha is conferred by overexpression of sigma factor sigB in Staphylococcus aureus.
J Antimicrob Chemother: 2005, 55(5);686-91
[PubMed:15761069] [WorldCat.org] [DOI] (P p)