From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0946 [new locus tag: SA_RS05365 ]
  • pan locus tag?: SAUPAN003320000
  • symbol: pdhD
  • pan gene symbol?: pdhD
  • synonym: lpdA
  • product: dihydrolipoamide dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0946 [new locus tag: SA_RS05365 ]
  • symbol: pdhD
  • product: dihydrolipoamide dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1074322..1075728
  • length: 1407
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGTAGTTGGAGATTTCCCAATTGAAACAGATACTATAGTAATCGGAGCAGGTCCTGGT
    GGATACGTTGCAGCAATTCGTGCAGCTCAATTAGGACAAAAAGTAACAATCGTTGAGAAA
    GGTAATCTTGGTGGTGTTTGCTTAAACGTAGGATGTATTCCTTCAAAAGCATTACTACAT
    GCTTCTCACCGTTTTGTTGAAGCACAACATTCTGAAAACTTAGGTGTTATTGCTGAAAGT
    GTTTCTTTAAACTTCCAAAAAGTTCAAGAATTCAAATCATCAGTTGTTAATAAATTAACT
    GGTGGTGTTGAAGGCTTACTTAAAGGTAACAAAGTTAACATCGTTAAAGGTGAAGCATAT
    TTCGTAGATAACAATAGCTTACGTGTTATGGACGAAAAGAGCGCACAAACATACAACTTT
    AAAAATGCAATCATTGCAACAGGTTCAAGACCAATTGAAATTCCTAATTTCAAATTCGGT
    AAACGTGTTATCGACTCAACAGGTGCTTTAAACTTACAAGAAGTACCAGGTAAATTAGTT
    GTAGTTGGTGGAGGATACATTGGATCAGAATTAGGTACAGCATTTGCTAACTTTGGTTCA
    GAAGTAACCATCCTTGAAGGTGCTAAAGATATCTTAGGTGGCTTCGAAAAACAAATGACA
    CAACCTGTTAAAAAAGGTATGAAAGAAAAAGGTGTTGAAATCGTTACTGAAGCTATGGCT
    AAATCAGCTGAAGAAACAGATAACGGAGTTAAAGTTACTTATGAAGCTAAAGGCGAAGAG
    AAAACAATCGAAGCTGATTATGTATTAGTAACTGTAGGTCGTCGTCCAAACACAGACGAA
    TTAGGCCTAGAAGAATTAGGTGTTAAATTCGCTGACCGTGGATTATTAGAAGTTGATAAA
    CAAAGCCGTACGTCTATCAGCAATATCTATGCAATTGGTGATATCGTTCCAGGTTTACCA
    CTTGCTCACAAAGCTAGCTATGAAGCTAAAGTTGCTGCTGAAGCAATTGATGGTCAAGCT
    GCTGAAGTTGATTACATTGGTATGCCAGCAGTATGCTTTACTGAACCAGAATTAGCTACA
    GTTGGTTATTCAGAAGCGCAAGCTAAAGAAGAAGGTTTAGCAATTAAAGCTTCTAAATTC
    CCATATGCAGCAAATGGTCGTGCATTATCATTAGATGATACTAACGGATTTGTTAAACTT
    ATTACACTTAAAGAAGATGATACTTTAATCGGTGCTCAAGTAGTTGGTACTGGTGCATCA
    GATATTATCTCTGAATTAGGTTTAGCAATTGAAGCTGGTATGAATGCTGAAGATATCGCA
    TTAACAATCCATGCACATCCAACATTAGGTGAGATGACTATGGAAGCAGCAGAAAAAGCT
    ATCGGATACCCAATCCATACAATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1407

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0946 [new locus tag: SA_RS05365 ]
  • symbol: PdhD
  • description: dihydrolipoamide dehydrogenase
  • length: 468
  • theoretical pI: 4.66989
  • theoretical MW: 49451
  • GRAVY: -0.00641026

Function[edit | edit source]

  • reaction:
    EC 1.8.1.4?  ExPASy
    Dihydrolipoyl dehydrogenase Protein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 565.5)
    and 42 more
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 369.4)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 286.6)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 257.6)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 247.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 213.5)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 161.1)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 115.3)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 64.6)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 56.6)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 56)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 48.8)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 42.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 41.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 38.3)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 38.1)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 37.9)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 34.7)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 32.3)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 27.8)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 21.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 20.5)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 17.2)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 16.3)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.9)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 15.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 15.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 15)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 14.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 13.4)
    Metabolism Energy metabolism Amino acids and amines alanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 12.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 11.2)
    Metabolism Energy metabolism Other 4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 11.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 11)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other carotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 10.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 8.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 7.6)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 6.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 4.7)
  • TheSEED  :
    • Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
    • Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
    Carbohydrates Central carbohydrate metabolism Dehydrogenase complexes  Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
    and 2 more
    Carbohydrates Central carbohydrate metabolism Pyruvate metabolism II: acetyl-CoA, acetogenesis from pyruvate  Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
    Carbohydrates Central carbohydrate metabolism TCA Cycle  Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 257.6)
    and 19 more
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 125.4)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 78.5)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 46.2)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 36.6)
    HI0933_like; HI0933-like protein Rossmann domain (PF03486; HMM-score: 36.3)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 33.2)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 29.9)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 27.7)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 21.8)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 20.6)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 19.2)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 17.3)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 16.2)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15.8)
    Thi4; Thi4 family (PF01946; HMM-score: 13.6)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 11.7)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 11.1)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 10.4)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 9.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.962
    • Cytoplasmic Membrane Score: 0.0081
    • Cell wall & surface Score: 0.0006
    • Extracellular Score: 0.0294
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.021819
    • TAT(Tat/SPI): 0.002475
    • LIPO(Sec/SPII): 0.001894
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVVGDFPIETDTIVIGAGPGGYVAAIRAAQLGQKVTIVEKGNLGGVCLNVGCIPSKALLHASHRFVEAQHSENLGVIAESVSLNFQKVQEFKSSVVNKLTGGVEGLLKGNKVNIVKGEAYFVDNNSLRVMDEKSAQTYNFKNAIIATGSRPIEIPNFKFGKRVIDSTGALNLQEVPGKLVVVGGGYIGSELGTAFANFGSEVTILEGAKDILGGFEKQMTQPVKKGMKEKGVEIVTEAMAKSAEETDNGVKVTYEAKGEEKTIEADYVLVTVGRRPNTDELGLEELGVKFADRGLLEVDKQSRTSISNIYAIGDIVPGLPLAHKASYEAKVAAEAIDGQAAEVDYIGMPAVCFTEPELATVGYSEAQAKEEGLAIKASKFPYAANGRALSLDDTNGFVKLITLKEDDTLIGAQVVGTGASDIISELGLAIEAGMNAEDIALTIHAHPTLGEMTMEAAEKAIGYPIHTM

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [2] (data from MRSA252)
    SA1533(ackA)acetate kinase  [2] (data from MRSA252)
    SA0562(adh1)alcohol dehydrogenase  [2] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [2] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [2] (data from MRSA252)
    SA2427(arcB)ornithine carbamoyltransferase  [2] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [2] (data from MRSA252)
    SA1234(cspA)cold-shock protein CspA  [2] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [2] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [2] (data from MRSA252)
    SA1941(dps)general stress protein 20U  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA0545(eutD)phosphotransacetylase  [2] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [2] (data from MRSA252)
    SA0915(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [2] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [2] (data from MRSA252)
    SA0505(fus)elongation factor G  [2] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [2] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [2] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [2] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [2] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [2] (data from MRSA252)
    SA1837(groES)co-chaperonin GroES  [2] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [2] (data from MRSA252)
    SA0819(gudB)NAD-specific glutamate dehydrogenase  [2] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [2] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [2] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [2] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [2] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SA0728(pgk)phosphoglycerate kinase  [2] (data from MRSA252)
    SA0730(pgm)phosphoglyceromutase  [2] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [2] (data from MRSA252)
    SA0935(ptsI)phosphoenolpyruvate-protein phosphatase  [2] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [2] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [2] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [2] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [2] (data from MRSA252)
    SA2040(rplP)50S ribosomal protein L16  [2] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [2] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [2] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [2] (data from MRSA252)
    SA1471(rpmA)50S ribosomal protein L27  [2] (data from MRSA252)
    SA2030(rpmD)50S ribosomal protein L30  [2] (data from MRSA252)
    SA1922(rpmE2)50S ribosomal protein L31  [2] (data from MRSA252)
    SA1503(rpmI)50S ribosomal protein L35  [2] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [2] (data from MRSA252)
    SA1930(rpoE)DNA-directed RNA polymerase subunit delta  [2] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [2] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [2] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [2] (data from MRSA252)
    SA1081(rpsP)30S ribosomal protein S16  [2] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [2] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SA1871(rsbV)anti-sigmaB factor antagonist  [2] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [2] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [2] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [2] (data from MRSA252)
    SA1506(thrS)threonyl-tRNA synthetase  [2] (data from MRSA252)
    SA1499(tig)trigger factor  [2] (data from MRSA252)
    SA1177(tkt)transketolase  [2] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [2] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [2] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [2] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [2] (data from MRSA252)
    SA0372hypothetical protein  [2] (data from MRSA252)
    SA0422hypothetical protein  [2] (data from MRSA252)
    SA0437hypothetical protein  [2] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [2] (data from MRSA252)
    SA0587hypothetical protein  [2] (data from MRSA252)
    SA0707hypothetical protein  [2] (data from MRSA252)
    SA0758hypothetical protein  [2] (data from MRSA252)
    SA0802hypothetical protein  [2] (data from MRSA252)
    SA0829hypothetical protein  [2] (data from MRSA252)
    SA0873hypothetical protein  [2] (data from MRSA252)
    SA1532hypothetical protein  [2] (data from MRSA252)
    SA1571D-alanine aminotransferase  [2] (data from MRSA252)
    SA1599translaldolase  [2] (data from MRSA252)
    SA1709hypothetical protein  [2] (data from MRSA252)
    SA1735manganese-dependent inorganic pyrophosphatase  [2] (data from MRSA252)
    SA2395L-lactate dehydrogenase  [2] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [2] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. 2.000 2.001 2.002 2.003 2.004 2.005 2.006 2.007 2.008 2.009 2.010 2.011 2.012 2.013 2.014 2.015 2.016 2.017 2.018 2.019 2.020 2.021 2.022 2.023 2.024 2.025 2.026 2.027 2.028 2.029 2.030 2.031 2.032 2.033 2.034 2.035 2.036 2.037 2.038 2.039 2.040 2.041 2.042 2.043 2.044 2.045 2.046 2.047 2.048 2.049 2.050 2.051 2.052 2.053 2.054 2.055 2.056 2.057 2.058 2.059 2.060 2.061 2.062 2.063 2.064 2.065 2.066 2.067 2.068 2.069 2.070 2.071 2.072 2.073 2.074 2.075 2.076 2.077 2.078 2.079 2.080 2.081 2.082 2.083 2.084 2.085 2.086 2.087 2.088 2.089 2.090 2.091 2.092 2.093 2.094 2.095 2.096 2.097 2.098 2.099 2.100 2.101 2.102 2.103 2.104 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)