From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SAS052 [new locus tag: SA_RS08675 ]
  • pan locus tag?: SAUPAN004372000
  • symbol: rpsD
  • pan gene symbol?: rpsD
  • synonym:
  • product: 30S ribosomal protein S4

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAS052 [new locus tag: SA_RS08675 ]
  • symbol: rpsD
  • product: 30S ribosomal protein S4
  • replicon: chromosome
  • strand: +
  • coordinates: 1760920..1761522
  • length: 603
  • essential: yes [1] DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGGCTCGATTCAGAGGTTCAAACTGGAAAAAATCTCGTCGTTTAGGTATCTCTTTAAGC
    GGTACTGGTAAAGAATTAGAAAAACGTCCTTACGCACCAGGACAACATGGTCCAAACCAA
    CGTAAAAAATTATCAGAATATGGTTTACAATTACGTGAAAAACAAAAATTACGTTACTTA
    TATGGAATGACTGAAAGACAATTCCGTAACACATTTGACATCGCTGGTAAAAAATTCGGT
    GTACACGGTGAAAACTTCATGATTTTATTAGCAAGTCGTTTAGACGCTGTTGTTTATTCA
    TTAGGTTTAGCTCGTACTCGTCGTCAAGCACGTCAATTAGTTAACCACGGTCATATCTTA
    GTAGATGGTAAACGTGTTGATATTCCATCTTATTCTGTTAAACCTGGTCAAACAATTTCA
    GTTCGTGAAAAATCTCAAAAATTAAACATCATCGTTGAATCAGTTGAAATCAACAATTTC
    GTACCTGAGTACTTAAACTTTGATGCTGACAGCTTAACTGGTACTTTCGTACGTTTACCA
    GAACGTAGCGAATTACCTGCTGAAATTAACGAACAATTAATCGTTGAGTACTACTCAAGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    603


⊟Protein[edit | edit source]

Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5TCU

⊟General[edit | edit source]

  • locus tag: SAS052 [new locus tag: SA_RS08675 ]
  • symbol: RpsD
  • description: 30S ribosomal protein S4
  • length: 200
  • theoretical pI: 10.559
  • theoretical MW: 23013.2
  • GRAVY: -0.607

⊟Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS4 (TIGR01017; HMM-score: 271.5)
    and 4 more
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS4 (TIGR01018; HMM-score: 52.7)
    Unknown function General TlyA family rRNA methyltransferase/putative hemolysin (TIGR00478; HMM-score: 28)
    Genetic information processing Protein synthesis tRNA and rRNA base modification pseudouridine synthase, RluA family (TIGR00005; EC 5.4.99.-; HMM-score: 14.8)
    Metabolism Energy metabolism Photosynthesis photosystem II S4 domain protein (TIGR03069; HMM-score: 14.8)
  • TheSEED  :
    • SSU ribosomal protein S4p (S9e)
    • SSU ribosomal protein S4p (S9e), zinc-independent
    Protein Metabolism Protein biosynthesis Ribosome SSU bacterial  SSU ribosomal protein S4p (S9e)
  • PFAM:
    S4 (CL0492) Ribosomal_S4; Ribosomal protein S4/S9 N-terminal domain (PF00163; HMM-score: 90.1)
    S4; S4 domain (PF01479; HMM-score: 73.5)
    and 1 more
    SYY_C-terminal; Tyrosine--tRNA ligase SYY-like C-terminal domain (PF22421; HMM-score: 20.9)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0.2528
    • Cytoplasmic Membrane Score: 0.0013
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.7459
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.016333
    • TAT(Tat/SPI): 0.011778
    • LIPO(Sec/SPII): 0.010986
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MARFRGSNWKKSRRLGISLSGTGKELEKRPYAPGQHGPNQRKKLSEYGLQLREKQKLRYLYGMTERQFRNTFDIAGKKFGVHGENFMILLASRLDAVVYSLGLARTRRQARQLVNHGHILVDGKRVDIPSYSVKPGQTISVREKSQKLNIIVESVEINNFVPEYLNFDADSLTGTFVRLPERSELPAEINEQLIVEYYSR

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA1984(asp23)alkaline shock protein 23  [2] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [2] (data from MRSA252)
    SA1098(codY)transcriptional repressor CodY  [2] (data from MRSA252)
    SA1940(deoD)purine nucleoside phosphorylase  [2] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA1074(fabG)3-oxoacyl-ACP reductase  [2] (data from MRSA252)
    SA1927(fbaA)fructose-bisphosphate aldolase  [2] (data from MRSA252)
    SA2057(fmhB)FmhB protein  [2] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [2] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [2] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [2] (data from MRSA252)
    SA0819(gudB)NAD-specific glutamate dehydrogenase  [2] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [2] (data from MRSA252)
    SA1504(infC)translation initiation factor IF-3  [2] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [2] (data from MRSA252)
    SA0038(mecA)penicillin binding protein 2 prime  [2] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA0686(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [2] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SA0730(pgm)phosphoglyceromutase  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA0014(rplI)50S ribosomal protein L9  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [2] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [2] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [2] (data from MRSA252)
    SA2040(rplP)50S ribosomal protein L16  [2] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [2] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [2] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [2] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [2] (data from MRSA252)
    SA1471(rpmA)50S ribosomal protein L27  [2] (data from MRSA252)
    SA2039(rpmC)50S ribosomal protein L29  [2] (data from MRSA252)
    SA1922(rpmE2)50S ribosomal protein L31  [2] (data from MRSA252)
    SA1503(rpmI)50S ribosomal protein L35  [2] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [2] (data from MRSA252)
    SA1930(rpoE)DNA-directed RNA polymerase subunit delta  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [2] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [2] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [2] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [2] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [2] (data from MRSA252)
    SA1116(rpsO)30S ribosomal protein S15  [2] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [2] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SA1177(tkt)transketolase  [2] (data from MRSA252)
    SA0295hypothetical protein  [2] (data from MRSA252)
    SA0437hypothetical protein  [2] (data from MRSA252)
    SA0627hypothetical protein  [2] (data from MRSA252)
    SA0637hypothetical protein  [2] (data from MRSA252)
    SA0707hypothetical protein  [2] (data from MRSA252)
    SA0759hypothetical protein  [2] (data from MRSA252)
    SA0802hypothetical protein  [2] (data from MRSA252)
    SA0940hypothetical protein  [2] (data from MRSA252)
    SA1223hypothetical protein  [2] (data from MRSA252)
    SA1360Xaa-Pro dipeptidase  [2] (data from MRSA252)
    SA1423hypothetical protein  [2] (data from MRSA252)
    SA1528hypothetical protein  [2] (data from MRSA252)
    SA1549hypothetical protein  [2] (data from MRSA252)
    SA1559hypothetical protein  [2] (data from MRSA252)
    SA1735manganese-dependent inorganic pyrophosphatase  [2] (data from MRSA252)
    SA1885hypothetical protein  [2] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.61 2.62 2.63 2.64 2.65 2.66 2.67 2.68 2.69 2.70 2.71 2.72 2.73 2.74 2.75 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]