Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0637 [new locus tag: SA_RS03645 ]
- pan locus tag?: SAUPAN002566000
- symbol: SA0637
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0637 [new locus tag: SA_RS03645 ]
- symbol: SA0637
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 730040..730723
- length: 684
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123444 NCBI
- RefSeq: NP_373892 NCBI
- BioCyc: see SA_RS03645
- MicrobesOnline: 102918 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGGATAAGAAAAAAGTCATCAAATTTATGATTAATGTATTACCAATTGTATTGGTACCG
TTAATTGTTGAACGTAAACGTATCAAACAACATCCGGACGTACAAAAAGTTACAGATGCT
ACAAGTAAAGTTGCTTCAAAAACATCTGCAGCAATCAGTAACACAGCGAGTGATGTTAAA
GAATATGTCGGCGATAAAAAACAAGATTTTGAAAATAAACGTGAACTTAAAAAGTTTGCT
AGAGAACATGATCCTGCCTATATTGAGAAAAAAGGCGAAAAATTAGCTAAACAAAATCGT
AAAGACGCTGATAAAATGAATAAAATACTTCAAAAAAATATCGAAAAGCGTCATAAAGAA
GAGCAAAAAGCCCGCGAAAAGAATGAAATACAACGTATTAAAGATATGAAAAAATCACAA
AAATACGAAGAAAAAGCAGGCTTAACACCTAATAAATTAGATGAGAAAACTGAGAAAAAA
GGCGATAAACTAGCTGAAAAAAATCGCAAAGAAATCGCTAAAATGAATAAAAAGTTACAA
AAAAATATTGAAAAACGACACAAAGAAGAACAAAAACGCCAACAAGAAGCTGATAAAGCA
CGCATCAAGTCATTTAAAAAATATAAAGATTATGTTGCCAAAAGCGCCTCTCAACAAAAT
AAAGAAAACAATACAGAGGCATAA60
120
180
240
300
360
420
480
540
600
660
684
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0637 [new locus tag: SA_RS03645 ]
- symbol: SA0637
- description: hypothetical protein
- length: 227
- theoretical pI: 10.6491
- theoretical MW: 26686.6
- GRAVY: -1.46432
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- FIG01108121: hypothetical protein
- PFAM: no clan defined Histone_HNS_N; H-NS histone-like proteins, N-terminal domain (PF22470; HMM-score: 16.7)and 2 moreCAF1A_acidic; Chromatin assembly factor 1 complex p150 subunit, acidic region (PF11600; HMM-score: 9.2)PDDEXK (CL0236) CdiA_C_tRNase; CdiA C-terminal tRNase domain (PF18664; HMM-score: 8.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0088
- Cytoplasmic Membrane Score: 0.658
- Cell wall & surface Score: 0.0091
- Extracellular Score: 0.3241
- LocateP: N-terminally anchored (No CS)
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.5
- Signal peptide possibility: -0.5
- N-terminally Anchored Score: 7
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.33941
- TAT(Tat/SPI): 0.004924
- LIPO(Sec/SPII): 0.032966
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MDKKKVIKFMINVLPIVLVPLIVERKRIKQHPDVQKVTDATSKVASKTSAAISNTASDVKEYVGDKKQDFENKRELKKFAREHDPAYIEKKGEKLAKQNRKDADKMNKILQKNIEKRHKEEQKAREKNEIQRIKDMKKSQKYEEKAGLTPNKLDEKTEKKGDKLAEKNRKEIAKMNKKLQKNIEKRHKEEQKRQQEADKARIKSFKKYKDYVAKSASQQNKENNTEA
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SA1504 (infC) translation initiation factor IF-3 [1] (data from MRSA252) SA0496 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SA2044 (rplB) 50S ribosomal protein L2 [1] (data from MRSA252) SA2047 (rplC) 50S ribosomal protein L3 [1] (data from MRSA252) SA2046 (rplD) 50S ribosomal protein L4 [1] (data from MRSA252) SA2033 (rplF) 50S ribosomal protein L6 [1] (data from MRSA252) SA0497 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SA0495 (rplK) 50S ribosomal protein L11 [1] (data from MRSA252) SA0498 (rplL) 50S ribosomal protein L7/L12 [1] (data from MRSA252) SA1084 (rplS) 50S ribosomal protein L19 [1] (data from MRSA252) SA1473 (rplU) 50S ribosomal protein L21 [1] (data from MRSA252) SA2042 (rplV) 50S ribosomal protein L22 [1] (data from MRSA252) SA2045 (rplW) 50S ribosomal protein L23 [1] (data from MRSA252) SA2016 (rpsI) 30S ribosomal protein S9 [1] (data from MRSA252) SA2024 (rpsK) 30S ribosomal protein S11 [1] (data from MRSA252) SA2038 (rpsQ) 30S ribosomal protein S17 [1] (data from MRSA252) SA0940 hypothetical protein [1] (data from MRSA252) SA1118 hypothetical protein [1] (data from MRSA252) SA1528 hypothetical protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SA0635 < SA0636 < SA0637
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)