From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1528 [new locus tag: SA_RS08600 ]
  • pan locus tag?: SAUPAN004355000
  • symbol: SA1528
  • pan gene symbol?: uspA2
  • synonym:
  • product: hypothetical protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SA1528 [new locus tag: SA_RS08600 ]
  • symbol: SA1528
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1746922..1747335
  • length: 414
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGTATAAAAATATATTACTTGGTGTAGACACTCAGTTAAAAAATGAAAAAGCACTAAAA
    GAAGTGTCTAAATTAGCTGGCGAAGGTACAGTCGTAACAGTTTTAAACGCAATCAGCGAA
    CAAGATGCTCAAGCATCAATTAAAGCAGGTGTTCATTTAAACAAACTTACTGAAGAACGA
    AGCAAGCGATTGGAAAAAACACGCAAAGCTTTAGAAGATTATGGTATTGATTATGACCAA
    ATAATTGTTCGTGGTAATGCAAAAGAAGAACTATTAAAACATGCTAATAGCGGTAAATAC
    GAAATTGTTGTTTTAAGTAACCGTAAAGCAGAAGACAAAAAGAAATTTGTACTTGGAAGT
    GTCAGCCACAAAGTAGCAAAACGTGCGACTATCCCTGTATTAATCGTTAAATAA
    60
    120
    180
    240
    300
    360
    414


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SA1528 [new locus tag: SA_RS08600 ]
  • symbol: SA1528
  • description: hypothetical protein
  • length: 137
  • theoretical pI: 10.274
  • theoretical MW: 15225.6
  • GRAVY: -0.394891

⊟Function[edit | edit source]

  • TIGRFAM:
    Unknown function Enzymes of unknown specificity HAD hydrolase, family IIIA (TIGR01662; HMM-score: 14)
  • TheSEED  :
    • Universal stress protein family
    Stress Response Stress Response - no subcategory Universal stress protein family  Universal stress protein family
  • PFAM:
    HUP (CL0039) Usp; Universal stress protein family (PF00582; HMM-score: 86.3)
    and 5 more
    CBM87 (CL0883) CBM87_Agd3; Agd3 CBM87 (PF25116; HMM-score: 19.4)
    no clan defined YfjL_C; YfjL-like C-terminal domain (PF24911; HMM-score: 14.4)
    Dak2; DAK2 domain (PF02734; HMM-score: 14.2)
    PFK (CL0240) DAGK_cat; Diacylglycerol kinase catalytic domain (PF00781; HMM-score: 13.7)
    TIM_barrel (CL0036) Pterin_bind; Pterin binding enzyme (PF00809; HMM-score: 13.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9756
    • Cytoplasmic Membrane Score: 0.0128
    • Cell wall & surface Score: 0.0031
    • Extracellular Score: 0.0085
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.014314
    • TAT(Tat/SPI): 0.000974
    • LIPO(Sec/SPII): 0.000837
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MYKNILLGVDTQLKNEKALKEVSKLAGEGTVVTVLNAISEQDAQASIKAGVHLNKLTEERSKRLEKTRKALEDYGIDYDQIIVRGNAKEELLKHANSGKYEIVVLSNRKAEDKKKFVLGSVSHKVAKRATIPVLIVK

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA2428(arcA)arginine deiminase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA0959hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]