Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1652 [new locus tag: SAUSA300_RS09015 ]
- pan locus tag?: SAUPAN004355000
- symbol: SAUSA300_1652
- pan gene symbol?: uspA2
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_1652 [new locus tag: SAUSA300_RS09015 ]
- symbol: SAUSA300_1652
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1817377..1817790
- length: 414
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3914606 NCBI
- RefSeq: YP_494346 NCBI
- BioCyc: see SAUSA300_RS09015
- MicrobesOnline: 1293167 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGTATAAAAATATATTACTTGGTGTAGACACTCAGTTAAAAAATGAAAAAGCACTAAAA
GAAGTGTCTAAATTAGCTGGCGAAGGTACAGTCGTAACAGTTTTAAACGCAATCAGCGAA
CAAGATGCTCAAGCATCAATTAAAGCAGGTGTTCATTTAAACAAACTTACTGAAGAACGA
AGCAAGCGATTGGAAAAAACACGCAAAGCTTTAGAAGATTATGGTATTGATTATGACCAA
ATAATTGTTCGTGGTAATGCAAAAGAAGAACTATTAAAACATGCTAATAGCGGTAAATAC
GAAATTGTTGTTTTAAGTAACCGTAAAGCAGAAGACAAAAAGAAATTTGTACTTGGAAGT
GTCAGCCACAAAGTAGCAAAACGTGCGACTATCCCTGTATTAATCGTTAAATAA60
120
180
240
300
360
414
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1652 [new locus tag: SAUSA300_RS09015 ]
- symbol: SAUSA300_1652
- description: hypothetical protein
- length: 137
- theoretical pI: 10.274
- theoretical MW: 15225.6
- GRAVY: -0.394891
⊟Function[edit | edit source]
- TIGRFAM: Unknown function Enzymes of unknown specificity HAD hydrolase, family IIIA (TIGR01662; HMM-score: 14)
- TheSEED :
- Universal stress protein family
- PFAM: HUP (CL0039) Usp; Universal stress protein family (PF00582; HMM-score: 81.8)and 2 morePFK (CL0240) DAGK_cat; Diacylglycerol kinase catalytic domain (PF00781; HMM-score: 14.2)no clan defined Dak2; DAK2 domain (PF02734; HMM-score: 13.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.014314
- TAT(Tat/SPI): 0.000974
- LIPO(Sec/SPII): 0.000837
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MYKNILLGVDTQLKNEKALKEVSKLAGEGTVVTVLNAISEQDAQASIKAGVHLNKLTEERSKRLEKTRKALEDYGIDYDQIIVRGNAKEELLKHANSGKYEIVVLSNRKAEDKKKFVLGSVSHKVAKRATIPVLIVK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAUSA300_2570 (arcA) arginine deiminase [1] (data from MRSA252) SAUSA300_0002 (dnaN) DNA polymerase III subunit beta [1] (data from MRSA252) SAUSA300_0532 (fusA) elongation factor G [1] (data from MRSA252) SAUSA300_1640 (icd) isocitrate dehydrogenase [1] (data from MRSA252) SAUSA300_1162 (infB) translation initiation factor IF-2 [1] (data from MRSA252) SAUSA300_2089 (pdp) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) SAUSA300_1644 (pyk) pyruvate kinase [1] (data from MRSA252) SAUSA300_0523 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SAUSA300_2201 (rplB) 50S ribosomal protein L2 [1] (data from MRSA252) SAUSA300_2204 (rplC) 50S ribosomal protein L3 [1] (data from MRSA252) SAUSA300_2203 (rplD) 50S ribosomal protein L4 [1] (data from MRSA252) SAUSA300_0524 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SAUSA300_2185 (rplO) 50S ribosomal protein L15 [1] (data from MRSA252) SAUSA300_1134 (rplS) 50S ribosomal protein L19 [1] (data from MRSA252) SAUSA300_1603 (rplU) 50S ribosomal protein L21 [1] (data from MRSA252) SAUSA300_2199 (rplV) 50S ribosomal protein L22 [1] (data from MRSA252) SAUSA300_2202 (rplW) 50S ribosomal protein L23 [1] (data from MRSA252) SAUSA300_1666 (rpsD) 30S ribosomal protein S4 [1] (data from MRSA252) SAUSA300_2171 (rpsI) 30S ribosomal protein S9 [1] (data from MRSA252) SAUSA300_2200 (rpsS) 30S ribosomal protein S19 [1] (data from MRSA252) SAUSA300_1305 (sucB) dihydrolipoamide succinyltransferase [1] (data from MRSA252) SAUSA300_0533 (tuf) elongation factor Tu [1] (data from MRSA252) SAUSA300_1009 (typA) GTP-binding protein [1] (data from MRSA252) SAUSA300_0531 30S ribosomal protein S7 [1] (data from MRSA252) SAUSA300_0658 LysR family transcriptional regulator [1] (data from MRSA252) SAUSA300_0844 hypothetical protein [1] (data from MRSA252) SAUSA300_0912 enoyl-(acyl carrier protein) reductase [1] (data from MRSA252) SAUSA300_1656 universal stress protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)