Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0742 [new locus tag: SACOL_RS03810 ]
- pan locus tag?: SAUPAN002566000
- symbol: SACOL0742
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0742 [new locus tag: SACOL_RS03810 ]
- symbol: SACOL0742
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 762492..763175
- length: 684
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3237147 NCBI
- RefSeq: YP_185621 NCBI
- BioCyc: see SACOL_RS03810
- MicrobesOnline: 912217 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGGATAAGAAAAAAGTCATCAAATTTATGATTAATGTATTACCAATTGTATTGGTACCG
TTAATTGTTGAACGTAAACGTATCAAACAACATCCGGACGTACAAAAAGTTACAGATGCT
ACAAGTAAAGTTGCTTCAAAAACATCTGCAGCAATCAGTAACACAGCGAGTGATGTTAAA
GAATATGTCGGCGATAAAAAACAAGATTTTGAAAATAAACGTGAACTTAAAAAGTTTGCT
AGAGAACATGATCCTGCCTATATTGAGAAAAAAGGCGAAAAATTAGCTAAACAAAATCGT
AAAGACGCTGATAAAATGAATAAAATACTTCAAAAAAATATCGAAAAGCGTCATAAAGAA
GAGCAAAAAGCCCGCGAAAAGAATGAAATACAACGTATTAAAGATATGAAAAAATCACAA
AAATACGAAGAAAAAGCAGGCTTAACACCTAATAAATTAGATGAGAAAACTGAGAAAAAA
GGCGATAAACTAGCTGAAAAAAATCGCAAAGAAATCGCTAAAATGAATAAAAAGTTACAA
AAAAATATTGAAAAACGACACAAAGAAGAACAAAAACGCCAACAAGAAGCTGATAAAGCA
CGCATCAAGTCATTTAAAAAATATAAAGATTATGTTGCCAAAAGCGCCTCTCAACAAAAT
AAAGAAAACAATACAGAGGCATAA60
120
180
240
300
360
420
480
540
600
660
684
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0742 [new locus tag: SACOL_RS03810 ]
- symbol: SACOL0742
- description: hypothetical protein
- length: 227
- theoretical pI: 10.6491
- theoretical MW: 26686.6
- GRAVY: -1.46432
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- FIG01108121: hypothetical protein
- PFAM: no clan defined Histone_HNS_N; H-NS histone-like proteins, N-terminal domain (PF22470; HMM-score: 16.7)and 2 moreCAF1A_acidic; Chromatin assembly factor 1 complex p150 subunit, acidic region (PF11600; HMM-score: 9.2)PDDEXK (CL0236) CdiA_C_tRNase; CdiA C-terminal tRNase domain (PF18664; HMM-score: 8.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0088
- Cytoplasmic Membrane Score: 0.658
- Cell wall & surface Score: 0.0091
- Extracellular Score: 0.3241
- LocateP: N-terminally anchored (No CS)
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.5
- Signal peptide possibility: -0.5
- N-terminally Anchored Score: 7
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.33941
- TAT(Tat/SPI): 0.004924
- LIPO(Sec/SPII): 0.032966
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MDKKKVIKFMINVLPIVLVPLIVERKRIKQHPDVQKVTDATSKVASKTSAAISNTASDVKEYVGDKKQDFENKRELKKFAREHDPAYIEKKGEKLAKQNRKDADKMNKILQKNIEKRHKEEQKAREKNEIQRIKDMKKSQKYEEKAGLTPNKLDEKTEKKGDKLAEKNRKEIAKMNKKLQKNIEKRHKEEQKRQQEADKARIKSFKKYKDYVAKSASQQNKENNTEA
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Signal peptide containing [1] [2]
- quantitative data / protein copy number per cell:
- interaction partners:
SACOL1727 (infC) translation initiation factor IF-3 [3] (data from MRSA252) SACOL0584 (rplA) 50S ribosomal protein L1 [3] (data from MRSA252) SACOL2236 (rplB) 50S ribosomal protein L2 [3] (data from MRSA252) SACOL2239 (rplC) 50S ribosomal protein L3 [3] (data from MRSA252) SACOL2238 (rplD) 50S ribosomal protein L4 [3] (data from MRSA252) SACOL2224 (rplF) 50S ribosomal protein L6 [3] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [3] (data from MRSA252) SACOL0583 (rplK) 50S ribosomal protein L11 [3] (data from MRSA252) SACOL0586 (rplL) 50S ribosomal protein L7/L12 [3] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [3] (data from MRSA252) SACOL1702 (rplU) 50S ribosomal protein L21 [3] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [3] (data from MRSA252) SACOL2237 (rplW) 50S ribosomal protein L23 [3] (data from MRSA252) SACOL2206 (rpsI) 30S ribosomal protein S9 [3] (data from MRSA252) SACOL2214 (rpsK) 30S ribosomal protein S11 [3] (data from MRSA252) SACOL2230 (rpsQ) 30S ribosomal protein S17 [3] (data from MRSA252) SACOL1098 hypothetical protein [3] (data from MRSA252) SACOL1294 metallo-beta-lactamase [3] (data from MRSA252) SACOL1753 universal stress protein [3] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: SigB* (activation) regulon
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: 12.12 h [6]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
J Bacteriol: 2004, 186(13);4085-99
[PubMed:15205410] [WorldCat.org] [DOI] (P p) - ↑ Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
The sigmaB regulon in Staphylococcus aureus and its regulation.
Int J Med Microbiol: 2006, 296(4-5);237-58
[PubMed:16644280] [WorldCat.org] [DOI] (P p) - ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)