From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0742 [new locus tag: SACOL_RS03810 ]
  • pan locus tag?: SAUPAN002566000
  • symbol: SACOL0742
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0742 [new locus tag: SACOL_RS03810 ]
  • symbol: SACOL0742
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 762492..763175
  • length: 684
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGATAAGAAAAAAGTCATCAAATTTATGATTAATGTATTACCAATTGTATTGGTACCG
    TTAATTGTTGAACGTAAACGTATCAAACAACATCCGGACGTACAAAAAGTTACAGATGCT
    ACAAGTAAAGTTGCTTCAAAAACATCTGCAGCAATCAGTAACACAGCGAGTGATGTTAAA
    GAATATGTCGGCGATAAAAAACAAGATTTTGAAAATAAACGTGAACTTAAAAAGTTTGCT
    AGAGAACATGATCCTGCCTATATTGAGAAAAAAGGCGAAAAATTAGCTAAACAAAATCGT
    AAAGACGCTGATAAAATGAATAAAATACTTCAAAAAAATATCGAAAAGCGTCATAAAGAA
    GAGCAAAAAGCCCGCGAAAAGAATGAAATACAACGTATTAAAGATATGAAAAAATCACAA
    AAATACGAAGAAAAAGCAGGCTTAACACCTAATAAATTAGATGAGAAAACTGAGAAAAAA
    GGCGATAAACTAGCTGAAAAAAATCGCAAAGAAATCGCTAAAATGAATAAAAAGTTACAA
    AAAAATATTGAAAAACGACACAAAGAAGAACAAAAACGCCAACAAGAAGCTGATAAAGCA
    CGCATCAAGTCATTTAAAAAATATAAAGATTATGTTGCCAAAAGCGCCTCTCAACAAAAT
    AAAGAAAACAATACAGAGGCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    684

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0742 [new locus tag: SACOL_RS03810 ]
  • symbol: SACOL0742
  • description: hypothetical protein
  • length: 227
  • theoretical pI: 10.6491
  • theoretical MW: 26686.6
  • GRAVY: -1.46432

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED  :
    • FIG01108121: hypothetical protein
  • PFAM:
    no clan defined Histone_HNS_N; H-NS histone-like proteins, N-terminal domain (PF22470; HMM-score: 16.7)
    and 2 more
    CAF1A_acidic; Chromatin assembly factor 1 complex p150 subunit, acidic region (PF11600; HMM-score: 9.2)
    PDDEXK (CL0236) CdiA_C_tRNase; CdiA C-terminal tRNase domain (PF18664; HMM-score: 8.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.0088
    • Cytoplasmic Membrane Score: 0.658
    • Cell wall & surface Score: 0.0091
    • Extracellular Score: 0.3241
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.5
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.33941
    • TAT(Tat/SPI): 0.004924
    • LIPO(Sec/SPII): 0.032966
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MDKKKVIKFMINVLPIVLVPLIVERKRIKQHPDVQKVTDATSKVASKTSAAISNTASDVKEYVGDKKQDFENKRELKKFAREHDPAYIEKKGEKLAKQNRKDADKMNKILQKNIEKRHKEEQKAREKNEIQRIKDMKKSQKYEEKAGLTPNKLDEKTEKKGDKLAEKNRKEIAKMNKKLQKNIEKRHKEEQKRQQEADKARIKSFKKYKDYVAKSASQQNKENNTEA

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Signal peptide containing [1] [2]
  • quantitative data / protein copy number per cell:
  • interaction partners:
    SACOL1727(infC)translation initiation factor IF-3  [3] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [3] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [3] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [3] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [3] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [3] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [3] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [3] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [3] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [3] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [3] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [3] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [3] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [3] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [3] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [3] (data from MRSA252)
    SACOL1098hypothetical protein  [3] (data from MRSA252)
    SACOL1294metallo-beta-lactamase  [3] (data from MRSA252)
    SACOL1753universal stress protein  [3] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB* (activation) regulon
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  [4] [5]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 12.12 h [6]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  4. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  5. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int J Med Microbiol: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]