Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA2427 [new locus tag: SA_RS13915 ]
- pan locus tag?: SAUPAN006363000
- symbol: arcB
- pan gene symbol?: arcB
- synonym:
- product: ornithine carbamoyltransferase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA2427 [new locus tag: SA_RS13915 ]
- symbol: arcB
- product: ornithine carbamoyltransferase
- replicon: chromosome
- strand: -
- coordinates: 2724560..2725570
- length: 1011
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1125356 NCBI
- RefSeq: NP_375753 NCBI
- BioCyc: see SA_RS13915
- MicrobesOnline: 104779 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961ATGACAGAAATTCAAAAACCGTATGATTTAAAAGGCAGATCATTATTAAAAGAAAGTGAT
TTTACCAAAGCAGAATTCGAAGGACTTATTGATTTTGCAATTACATTAAAAGAGTATAAG
AAAAACGGTATTAAGCATCACTACTTATCTGGAAAAAATATTGCACTACTATTCGAAAAG
AATTCGACGAGAACGCGTGCAGCGTTTACAGTTGCGTCTATTGATTTAGGTGCGCATCCA
GAATTTTTAGGGAAAAATGATATTCAATTAGGCAAAAAAGAATCTGTAGAGGATACTGCG
AAAGTATTAGGTAGAATGTTCGATGGTATTGAATTCCGTGGTTTTTCACAACAAGCTGTT
GAAGATTTAGCGAAGTTCTCTGGTGTACCGGTGTGGAATGGATTAACAGACGATTGGCAT
CCTACACAAATGTTAGCTGATTTTATGACAATAAAAGAGAATTTTGGATATCTAGAAGGA
ATAAACTTAACTTACGTTGGAGATGGACGTAATAATATTGCGCATTCATTAATGGTAGCA
GGTGCTATGTTAGGTGTTAATGTAAGAATTTGTACACCTAAATCATTAAATCCAAAAGAG
GCATATGTTGATATTGCAAAAGAAAAAGCGAGTCAATATGGTGGTTCAATCATGATTACG
GATAATATTGCAGAAGCAGTTGAAAATACAGATGCTATATATACAGATGTTTGGGTATCG
ATGGGTGAAGAAAGTGAATTTGAACAACGTATTAATTTATTAAAAGACTATCAAGTGAAT
CAACAGATGTTTGATTTAACAGGTAAAGATTCAACGATATTCTTACATTGTTTACCAGCA
TTCCATGATACAAATACACTTTATGGACAAGAAATTTATGAAAAATATGGATTAGCTGAA
ATGGAAGTTACAGACCAAATCTTTAGAAGTGAACATTCAAAAGTGTTTGATCAAGCTGAA
AATAGAATGCATACAATTAAGGCAGTAATGGCAGCAACATTGGGGAGTTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1011
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA2427 [new locus tag: SA_RS13915 ]
- symbol: ArcB
- description: ornithine carbamoyltransferase
- length: 336
- theoretical pI: 4.94437
- theoretical MW: 37776.6
- GRAVY: -0.330655
⊟Function[edit | edit source]
- reaction: EC 2.1.3.3? ExPASyOrnithine carbamoyltransferase Carbamoyl phosphate + L-ornithine = phosphate + L-citrulline
- TIGRFAM: Amino acid biosynthesis Glutamate family ornithine carbamoyltransferase (TIGR00658; EC 2.1.3.3; HMM-score: 414.2)and 3 moreEnergy metabolism Amino acids and amines putrescine carbamoyltransferase (TIGR04384; EC 2.1.3.6; HMM-score: 261.4)Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis aspartate carbamoyltransferase (TIGR00670; EC 2.1.3.2; HMM-score: 125.2)knotted carbamoyltransferase YgeW (TIGR03316; EC 2.1.3.-; HMM-score: 71.1)
- TheSEED :
- Ornithine carbamoyltransferase (EC 2.1.3.3)
Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine and Ornithine Degradation Ornithine carbamoyltransferase (EC 2.1.3.3)and 2 more - PFAM: NADP_Rossmann (CL0063) OTCace; Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain (PF00185; HMM-score: 196.2)no clan defined OTCace_N; Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain (PF02729; HMM-score: 157)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9402
- Cytoplasmic Membrane Score: 0.0005
- Cell wall & surface Score: 0
- Extracellular Score: 0.0592
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.001766
- TAT(Tat/SPI): 0.000557
- LIPO(Sec/SPII): 0.000344
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTEIQKPYDLKGRSLLKESDFTKAEFEGLIDFAITLKEYKKNGIKHHYLSGKNIALLFEKNSTRTRAAFTVASIDLGAHPEFLGKNDIQLGKKESVEDTAKVLGRMFDGIEFRGFSQQAVEDLAKFSGVPVWNGLTDDWHPTQMLADFMTIKENFGYLEGINLTYVGDGRNNIAHSLMVAGAMLGVNVRICTPKSLNPKEAYVDIAKEKASQYGGSIMITDNIAEAVENTDAIYTDVWVSMGEESEFEQRINLLKDYQVNQQMFDLTGKDSTIFLHCLPAFHDTNTLYGQEIYEKYGLAEMEVTDQIFRSEHSKVFDQAENRMHTIKAVMAATLGS
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: arcC < arcD < arcB < arcA
⊟Regulation[edit | edit source]
- regulators: Rex* (repression) regulon, ArcR* (activation) regulon, ArgR* (repression) regulon, CcpA regulon
Rex* (TF) important in Energy metabolism; RegPrecise ArcR* (TF) important in Arginine degradation; RegPrecise ArgR* (TF) important in Arginine biosynthesis, Arginine degradation; RegPrecise CcpA (TF) important in Carbon catabolism; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)