From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_001399
  • pan locus tag?: SAUPAN003835000
  • symbol: arlR
  • pan gene symbol?: arlR
  • synonym:
  • product: response regulator transcription factor ArlR

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_001399
  • symbol: arlR
  • product: response regulator transcription factor ArlR
  • replicon: chromosome
  • strand: -
  • coordinates: 1416486..1417145
  • length: 660
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGCAAATTTTAATAGTAGAAGATGAACAAAACTTAGCAAGATTTCTTGAATTGGAA
    CTCACACATGAAAATTACAATGTGGACACAGAGTATGATGGACAAGACGGTTTAGATAAA
    GCGCTTAGCCATTACTATGATTTAATCATATTAGATTTAATGTTGCCGTCAATTAATGGC
    TTAGAAATTTGTCGCAAAATTAGACAACAACAATCTACACCTATCATTATAATTACAGCG
    AAAAGTGATACGTATGACAAAGTTGCTGGGCTTGATTACGGTGCAGACGATTATATAGTT
    AAGCCATTTGATATTGAAGAACTTTTAGCAAGAATTCGTGCAATTTTACGTCGTCAGCCA
    CAAAAGGATATTATCGATGTCAACGGTATTACAATTGATAAGAATGCTTTTAAAGTGACG
    GTAAATGGCGCAGAAATTGAATTAACAAAAACAGAGTATGATTTACTATATCTTCTAGCT
    GAAAATAAAAACCATGTTATGCAACGGGAACAAATTTTAAATCATGTATGGGGTTATAAT
    AGTGAAGTAGAAACAAATGTCGTAGATGTTTATATAAGATATTTACGAAACAAGTTAAAA
    CCATACGATCGTGACAAAATGATTGAAACAGTTCGTGGCGTTGGGTATGTAATACGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: JSNZ_001399
  • symbol: ArlR
  • description: response regulator transcription factor ArlR
  • length: 219
  • theoretical pI: 4.63339
  • theoretical MW: 25497.9
  • GRAVY: -0.331507

⊟Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 221)
    and 8 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 113.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 57.7)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 32.6)
    Signal transduction Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 31)
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions putative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 13)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 108.9)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 100.4)
    and 4 more
    E-set (CL0159) Glucodextran_B; Glucodextranase, domain B (PF09136; HMM-score: 17.4)
    CheY (CL0304) iREC; Inactive Receiver domain (PF22563; HMM-score: 17)
    GlnR_1st; Transcription regulator GlnR, N-terminal domain (PF21695; HMM-score: 13.3)
    PDE8A_N; PDE8A-like, N-terminal domain (PF23198; HMM-score: 13.2)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.991
    • Cytoplasmic Membrane Score: 0.0015
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0073
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001435
    • TAT(Tat/SPI): 0.000091
    • LIPO(Sec/SPII): 0.000226
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

⊟Protein sequence[edit | edit source]

  • MTQILIVEDEQNLARFLELELTHENYNVDTEYDGQDGLDKALSHYYDLIILDLMLPSINGLEICRKIRQQQSTPIIIITAKSDTYDKVAGLDYGADDYIVKPFDIEELLARIRAILRRQPQKDIIDVNGITIDKNAFKVTVNGAEIELTKTEYDLLYLLAENKNHVMQREQILNHVWGYNSEVETNVVDVYIRYLRNKLKPYDRDKMIETVRGVGYVIR

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulators: Fur* (repression) regulon, SaeR (activation) regulon, SigB (activation) regulon
    Fur*(TF)important in Iron homeostasis;  regulation predicted or transferred from N315 and NCTC 8325  [2]
    SaeR(TF)important in Virulence;  regulation predicted or transferred from N315 and NCTC 8325  [2]
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  regulation predicted or transferred from N315 and NCTC 8325  [3] [4] [5]   other strains

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. ↑ 2.0 2.1 Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
    Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
    Curr Res Microb Sci: 2025, 9;100489
    [PubMed:41146725] [WorldCat.org] [DOI] (I e)
  3. ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  4. ↑ Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int J Med Microbiol: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  5. ↑ Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J Bacteriol: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=JSNZ_001399&oldid=107040"