From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_001399
  • pan locus tag?: SAUPAN003835000
  • symbol: arlR
  • pan gene symbol?: arlR
  • synonym:
  • product: response regulator transcription factor ArlR

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_001399
  • symbol: arlR
  • product: response regulator transcription factor ArlR
  • replicon: chromosome
  • strand: -
  • coordinates: 1416486..1417145
  • length: 660
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGCAAATTTTAATAGTAGAAGATGAACAAAACTTAGCAAGATTTCTTGAATTGGAA
    CTCACACATGAAAATTACAATGTGGACACAGAGTATGATGGACAAGACGGTTTAGATAAA
    GCGCTTAGCCATTACTATGATTTAATCATATTAGATTTAATGTTGCCGTCAATTAATGGC
    TTAGAAATTTGTCGCAAAATTAGACAACAACAATCTACACCTATCATTATAATTACAGCG
    AAAAGTGATACGTATGACAAAGTTGCTGGGCTTGATTACGGTGCAGACGATTATATAGTT
    AAGCCATTTGATATTGAAGAACTTTTAGCAAGAATTCGTGCAATTTTACGTCGTCAGCCA
    CAAAAGGATATTATCGATGTCAACGGTATTACAATTGATAAGAATGCTTTTAAAGTGACG
    GTAAATGGCGCAGAAATTGAATTAACAAAAACAGAGTATGATTTACTATATCTTCTAGCT
    GAAAATAAAAACCATGTTATGCAACGGGAACAAATTTTAAATCATGTATGGGGTTATAAT
    AGTGAAGTAGAAACAAATGTCGTAGATGTTTATATAAGATATTTACGAAACAAGTTAAAA
    CCATACGATCGTGACAAAATGATTGAAACAGTTCGTGGCGTTGGGTATGTAATACGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_001399
  • symbol: ArlR
  • description: response regulator transcription factor ArlR
  • length: 219
  • theoretical pI: 4.63339
  • theoretical MW: 25497.9
  • GRAVY: -0.331507

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 221)
    and 8 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 113.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 57.7)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 32.6)
    Signal transduction Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 31)
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions putative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 13)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 108.9)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 100.4)
    and 4 more
    E-set (CL0159) Glucodextran_B; Glucodextranase, domain B (PF09136; HMM-score: 17.4)
    CheY (CL0304) iREC; Inactive Receiver domain (PF22563; HMM-score: 17)
    GlnR_1st; Transcription regulator GlnR, N-terminal domain (PF21695; HMM-score: 13.3)
    PDE8A_N; PDE8A-like, N-terminal domain (PF23198; HMM-score: 13.2)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.991
    • Cytoplasmic Membrane Score: 0.0015
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0073
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001435
    • TAT(Tat/SPI): 0.000091
    • LIPO(Sec/SPII): 0.000226
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MTQILIVEDEQNLARFLELELTHENYNVDTEYDGQDGLDKALSHYYDLIILDLMLPSINGLEICRKIRQQQSTPIIIITAKSDTYDKVAGLDYGADDYIVKPFDIEELLARIRAILRRQPQKDIIDVNGITIDKNAFKVTVNGAEIELTKTEYDLLYLLAENKNHVMQREQILNHVWGYNSEVETNVVDVYIRYLRNKLKPYDRDKMIETVRGVGYVIR

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulators: Fur* (repression) regulon, SaeR (activation) regulon, SigB (activation) regulon
    Fur*(TF)important in Iron homeostasis;  transcription unit predicted or transferred from N315 and NCTC8325 
    SaeR(TF)important in Virulence;  transcription unit predicted or transferred from N315 and NCTC8325 
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  transcription unit predicted or transferred from N315 and NCTC8325  [2] [3] [4]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  3. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int J Med Microbiol: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  4. Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J Bacteriol: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]