From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_000801
  • pan locus tag?: SAUPAN002894000
  • symbol: sufC
  • pan gene symbol?: sufC
  • synonym:
  • product: Fe-S cluster assembly ATPase SufC

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_000801
  • symbol: sufC
  • product: Fe-S cluster assembly ATPase SufC
  • replicon: chromosome
  • strand: +
  • coordinates: 831086..831847
  • length: 762
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCATCAACATTAGAAATCAAAGACCTACATGTGTCTATTGAGGATAAAGAAATCTTA
    AAAGGTGTTAACTTGACAATTAACACTGATGAAATACATGCGATTATGGGACCAAACGGG
    ACAGGTAAATCAACTTTATCATCTGCAATTATGGGACACCCAAGCTATGAAGTAACTAAA
    GGAGAAGTACTTTTAGACGGTGTAAATATTTTAGAATTAGAAGTTGATGAAAGAGCAAAA
    GCAGGATTATTCTTGGCAATGCAATATCCATCAGAAATTACAGGTGTTACAAATGCTGAT
    TTCATGCGTTCAGCAATCAATGCGAAACGTGAAGAAGGACAAGAAATCAACTTAATGCAA
    TTTATTAAGAAATTAGATAAAAACATGGATTTTCTAGACATAGATAAAGACATGGCACAA
    CGTTATTTAAATGAAGGTTTCTCAGGTGGAGAGAAGAAACGTAACGAAATCTTACAATTA
    ATGATGTTAGAACCTAAGTTTGCAATCTTAGATGAAATCGATTCAGGGTTAGACATCGAT
    GCATTAAAAGTTGTATCTAAAGGTATTAACCAAATGCGTGGGGAAAACTTTGGTGCATTA
    ATGATTACACACTATCAACGATTATTAAATTACATTACTCCTGATAAAGTACATGTAATG
    TATGCTGGTAAAGTCGTTAAATCTGGTGGTCCAGAATTAGCAAAACGTCTTGAAGAAGAA
    GGATATGAATGGGTTAAAGAAGAGTTCGGTTCAGCTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    762

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: JSNZ_000801
  • symbol: SufC
  • description: Fe-S cluster assembly ATPase SufC
  • length: 253
  • theoretical pI: 4.61058
  • theoretical MW: 28275.2
  • GRAVY: -0.303162

⊟Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 369.2)
    and 73 more
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 104)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 83.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 81.4)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 81.3)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 74.1)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 73.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 72.9)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 70.9)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 69.1)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 69)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 67.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 67.8)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 66.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 65.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 65.3)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 65)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 63.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 61.8)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 59.9)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 59)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 58.9)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 58.9)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 57.4)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 56.5)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 56.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 56.2)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 56.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 56.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 55.6)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 55.4)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 55.4)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 52.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 51.2)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 51.2)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 51.2)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 50.9)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 50.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 49.9)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 49.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 49)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 48.7)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 47.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 47.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 47.3)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 47.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 45.3)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 43.3)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 42.3)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 42.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 41.7)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 41.1)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 41)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 40.2)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 40.2)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 39.9)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 39.5)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 39.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 38)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 37.5)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 36.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 29.4)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 29.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 26)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 26)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 24.3)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 19.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 19.2)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 16.7)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 15.3)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 15.3)
    carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 12.7)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 12.2)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 81.8)
    and 21 more
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 35.9)
    Aha1_BPI (CL0648) DUF1439; Protein of unknown function (DUF1439) (PF07273; HMM-score: 20.3)
    P-loop_NTPase (CL0023) AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 20)
    AAA_28; AAA domain (PF13521; HMM-score: 19.8)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 17.3)
    AAA_27; AAA domain (PF13514; HMM-score: 16.7)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 16.4)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 16.2)
    AAA_18; AAA domain (PF13238; HMM-score: 16.2)
    AAA_14; AAA domain (PF13173; HMM-score: 16.1)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 15.2)
    AAA_23; AAA domain (PF13476; HMM-score: 15)
    AAA_13; AAA domain (PF13166; HMM-score: 14.3)
    AAA_33; AAA domain (PF13671; HMM-score: 14)
    no clan defined PFam54_60; Borrelia Bbcrasp-1 domain containing protein (PF05714; HMM-score: 13.6)
    P-loop_NTPase (CL0023) AAA_25; AAA domain (PF13481; HMM-score: 13.5)
    GT-B (CL0113) Glyco_trans_4_2; Glycosyl transferase 4-like (PF13477; HMM-score: 13.4)
    P-loop_NTPase (CL0023) AAA_22; AAA domain (PF13401; HMM-score: 13.3)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13.2)
    Adhesin (CL0204) Sgo0707_N2; Sgo0707 N2 domain (PF20623; HMM-score: 12)
    no clan defined DUF1420; Protein of unknown function (DUF1420) (PF07220; HMM-score: 10.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.73
    • Cytoplasmic Membrane Score: 0.2395
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0304
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007752
    • TAT(Tat/SPI): 0.000871
    • LIPO(Sec/SPII): 0.000474
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

⊟Protein sequence[edit | edit source]

  • MASTLEIKDLHVSIEDKEILKGVNLTINTDEIHAIMGPNGTGKSTLSSAIMGHPSYEVTKGEVLLDGVNILELEVDERAKAGLFLAMQYPSEITGVTNADFMRSAINAKREEGQEINLMQFIKKLDKNMDFLDIDKDMAQRYLNEGFSGGEKKRNEILQLMMLEPKFAILDEIDSGLDIDALKVVSKGINQMRGENFGALMITHYQRLLNYITPDKVHVMYAGKVVKSGGPELAKRLEEEGYEWVKEEFGSAE

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulators: PerR (repression) regulon, SigB (activation) regulon
    PerR(TF)important in Oxidative stress response;  regulation predicted or transferred from N315 and NCTC 8325  [2]
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation;  regulation predicted or transferred from N315 and NCTC 8325  [3] [4] [5]   other strains

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. ↑ Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
    Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
    Curr Res Microb Sci: 2025, 9;100489
    [PubMed:41146725] [WorldCat.org] [DOI] (I e)
  3. ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  4. ↑ Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int J Med Microbiol: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  5. ↑ Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J Bacteriol: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=JSNZ_000801&oldid=106442"