From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01228
  • pan locus tag?: SAUPAN003553000
  • symbol: SAOUHSC_01228
  • pan gene symbol?: codY
  • synonym:
  • product: transcriptional repressor CodY

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01228
  • symbol: SAOUHSC_01228
  • product: transcriptional repressor CodY
  • replicon: chromosome
  • strand: +
  • coordinates: 1179705..1180478
  • length: 774
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGCTTATTATCTAAAACGAGAGAGTTAAACACGTTACTTCAAAAACACAAAGGTATT
    GCGGTTGATTTTAAAGATGTAGCACAAACGATTAGTAGCGTAACTGTAACAAATGTATTT
    ATTGTATCGCGTCGAGGTAAAATTTTAGGATCGAGTCTAAATGAATTATTAAAAAGTCAA
    AGAATTATTCAAATGTTGGAAGAAAGACATATTCCAAGTGAATATACAGAACGATTAATG
    GAAGTTAAACAAACAGAATCAAATATTGATATCGACAATGTATTAACAGTATTCCCACCT
    GAAAACAGAGAATTATTCATAGATAGTCGTACAACTATCTTCCCAATTTTAGGTGGAGGG
    GAAAGATTAGGTACATTAGTACTTGGTCGAGTACATGATGATTTTAATGAAAATGATTTG
    GTACTAGGTGAATATGCTGCTACAGTTATTGGTATGGAAATCTTACGTGAGAAGCATAGT
    GAAGTAGAAAAAGAAGCGCGCGATAAAGCTGCTATTACAATGGCAATTAATTCATTATCT
    TATTCTGAAAAAGAAGCGATTGAACATATCTTTGAAGAACTTGGCGGTACGGAAGGCCTA
    TTAATCGCATCAAAAGTTGCAGATAGAGTTGGTATTACTAGATCTGTAATTGTAAATGCA
    CTACGTAAATTAGAAAGTGCTGGTGTAATTGAATCACGTTCTTTAGGAATGAAAGGTACT
    TTCATTAAAGTTAAAAAAGAAAAATTCTTAGATGAATTAGAAAAAAGTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    774


⊟Protein[edit | edit source]

Protein Data Bank: 5EY0
Protein Data Bank: 5EY1

⊟General[edit | edit source]

  • locus tag: SAOUHSC_01228
  • symbol: SAOUHSC_01228
  • description: transcriptional repressor CodY
  • length: 257
  • theoretical pI: 6.07842
  • theoretical MW: 28754.9
  • GRAVY: -0.178599

⊟Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions GTP-sensing transcriptional pleiotropic repressor CodY (TIGR02787; HMM-score: 351.8)
    and 3 more
    Signal transduction Regulatory functions DNA interactions CRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 20.1)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 15.4)
    Unknown function General Rrf2 family protein (TIGR00738; HMM-score: 14.3)
  • TheSEED  :
    • GTP-sensing transcriptional pleiotropic repressor CodY
    Conserved gene cluster associated with Met-tRNA formyltransferase  GTP-sensing transcriptional pleiotropic repressor codY
  • PFAM:
    GAF (CL0161) CodY; CodY GAF-like domain (PF06018; HMM-score: 234.2)
    and 21 more
    HTH (CL0123) HTH_CodY; CodY helix-turn-helix domain (PF08222; HMM-score: 104.6)
    Ribosomal_S25; S25 ribosomal protein (PF03297; HMM-score: 23.4)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 20.3)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 18.3)
    HTH_11; HTH domain (PF08279; HMM-score: 17.8)
    HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 17.4)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 17.2)
    Rrf2; Iron-dependent Transcriptional regulator (PF02082; HMM-score: 16.9)
    MarR_2; MarR family (PF12802; HMM-score: 16.9)
    GAF (CL0161) GAF_2; GAF domain (PF13185; HMM-score: 16.3)
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 15.4)
    HTH_27; Winged helix DNA-binding domain (PF13463; HMM-score: 15.3)
    DUF4423; Domain of unknown function (DUF4423) (PF14394; HMM-score: 15.3)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.1)
    SoFic-like_C; Protein adenylyltransferase SoFic-like, C-terminal domain (PF21248; HMM-score: 13.7)
    GAF (CL0161) GAF; GAF domain (PF01590; HMM-score: 13.3)
    HTH (CL0123) HTH_41; Helix-turn-helix domain (PF14502; HMM-score: 13.3)
    HTH_8; Bacterial regulatory protein, Fis family (PF02954; HMM-score: 12.5)
    no clan defined Coa3_cc; Cytochrome c oxidase assembly factor 3 (PF09813; HMM-score: 12.5)
    HTH (CL0123) HxlR; HxlR-like helix-turn-helix (PF01638; HMM-score: 12.1)
    DUF7343; Domain of unknown function (DUF7343) (PF24034; HMM-score: 10.6)

⊟Structure, modifications & cofactors[edit | edit source]

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9663
    • Cytoplasmic Membrane Score: 0.0296
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.004
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001202
    • TAT(Tat/SPI): 0.000369
    • LIPO(Sec/SPII): 0.000274
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MSLLSKTRELNTLLQKHKGIAVDFKDVAQTISSVTVTNVFIVSRRGKILGSSLNELLKSQRIIQMLEERHIPSEYTERLMEVKQTESNIDIDNVLTVFPPENRELFIDSRTTIFPILGGGERLGTLVLGRVHDDFNENDLVLGEYAATVIGMEILREKHSEVEKEARDKAAITMAINSLSYSEKEAIEHIFEELGGTEGLLIASKVADRVGITRSVIVNALRKLESAGVIESRSLGMKGTFIKVKKEKFLDELEKSK

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [3] [4]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Yoann Augagneur, Alyssa N King, Noëlla Germain-Amiot, Mohamed Sassi, John W Fitzgerald, Gyan S Sahukhal, Mohamed O Elasri, Brice Felden, Shaun R Brinsmade
    Analysis of the CodY RNome reveals RsaD as a stress-responsive riboregulator of overflow metabolism in Staphylococcus aureus.
    Mol Microbiol: 2020, 113(2);309-325
    [PubMed:31696578] [WorldCat.org] [DOI] (I p)
  2. ↑ Arnab Basu, Kathryn E Shields, Christopher S Eickhoff, Daniel F Hoft, M N Yap
    Thermal and Nutritional Regulation of Ribosome Hibernation in Staphylococcus aureus.
    J Bacteriol: 2018, 200(24);
    [PubMed:30297357] [WorldCat.org] [DOI] (I e)
  3. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  5. ↑ 5.0 5.1 5.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]