From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_03003
  • pan locus tag?: SAUPAN006412000
  • symbol: SAOUHSC_03003
  • pan gene symbol?: icaD
  • synonym:
  • product: hypothetical protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_03003
  • symbol: SAOUHSC_03003
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2776376..2776681
  • length: 306
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
    GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
    GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
    TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
    ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
    TCGTGA
    60
    120
    180
    240
    300
    306


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_03003
  • symbol: SAOUHSC_03003
  • description: hypothetical protein
  • length: 101
  • theoretical pI: 5.82065
  • theoretical MW: 11782.9
  • GRAVY: 0.670297

⊟Function[edit | edit source]

  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides intracellular adhesion protein D (TIGR03932; HMM-score: 132.7)
    and 2 more
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)
    integral membrane protein (TIGR04561; HMM-score: 5)
  • TheSEED  :
    • Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaD
    Regulation and Cell signaling Quorum sensing and biofilm formation Biofilm formation in Staphylococcus  Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaD
  • PFAM:
    APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.1)
    and 4 more
    Transporter (CL0375) TMEM127; Transmembrane protein 127 (PF20517; HMM-score: 14.2)
    TrbL (CL0698) TrbL_4; Conjugal transfer protein TrbL (PF19597; HMM-score: 13.2)
    no clan defined DUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 12.6)
    DUF2207_C; Predicted membrane protein (DUF2207) C-terminal domain (PF20990; HMM-score: 11.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.9886
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0113
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000853
    • TAT(Tat/SPI): 0.000208
    • LIPO(Sec/SPII): 0.023432
  • predicted transmembrane helices (TMHMM): 2

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulators: CodY* (repression) regulon, IcaR* (repression) regulon
    CodY*(TF)important in Amino acid metabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    IcaR*(TF)important in Intercellular adhesion; RegPrecise    transcription unit transferred from N315 data RegPrecise 

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

S E Cramton, C Gerke, N F Schnell, W W Nichols, F Götz
The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation.
Infect Immun: 1999, 67(10);5427-33
[PubMed:10496925] [WorldCat.org] [DOI] (P p)
Ursula Fluckiger, Martina Ulrich, Andrea Steinhuber, Gerd Döring, Dietrich Mack, Regine Landmann, Christiane Goerke, Christiane Wolz
Biofilm formation, icaADBC transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device-related infection model.
Infect Immun: 2005, 73(3);1811-9
[PubMed:15731082] [WorldCat.org] [DOI] (P p)
C Heilmann, O Schweitzer, C Gerke, N Vanittanakom, D Mack, F Götz
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis.
Mol Microbiol: 1996, 20(5);1083-91
[PubMed:8809760] [WorldCat.org] [DOI] (P p)