⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_03003
- pan locus tag?: SAUPAN006412000
- symbol: SAOUHSC_03003
- pan gene symbol?: icaD
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_03003
- symbol: SAOUHSC_03003
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 2776376..2776681
- length: 306
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3921485 NCBI
- RefSeq: YP_501452 NCBI
- BioCyc: G1I0R-2825 BioCyc
- MicrobesOnline: 1291423 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
TCGTGA60
120
180
240
300
306
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_03003
- symbol: SAOUHSC_03003
- description: hypothetical protein
- length: 101
- theoretical pI: 5.82065
- theoretical MW: 11782.9
- GRAVY: 0.670297
⊟Function[edit | edit source]
- TIGRFAM: Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides intracellular adhesion protein D (TIGR03932; HMM-score: 132.7)and 2 moreCell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)integral membrane protein (TIGR04561; HMM-score: 5)
- TheSEED :
- Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaD
- PFAM: APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.1)and 4 moreTransporter (CL0375) TMEM127; Transmembrane protein 127 (PF20517; HMM-score: 14.2)TrbL (CL0698) TrbL_4; Conjugal transfer protein TrbL (PF19597; HMM-score: 13.2)no clan defined DUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 12.6)DUF2207_C; Predicted membrane protein (DUF2207) C-terminal domain (PF20990; HMM-score: 11.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.01
- Cytoplasmic Membrane Score: 9.99
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 2
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9886
- Cell wall & surface Score: 0
- Extracellular Score: 0.0113
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.000853
- TAT(Tat/SPI): 0.000208
- LIPO(Sec/SPII): 0.023432
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulators: CodY* (repression) regulon, IcaR* (repression) regulon
CodY* (TF) important in Amino acid metabolism; RegPrecise transcription unit transferred from N315 data RegPrecise IcaR* (TF) important in Intercellular adhesion; RegPrecise transcription unit transferred from N315 data RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [1]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
⊟Relevant publications[edit | edit source]
S E Cramton, C Gerke, N F Schnell, W W Nichols, F Götz
The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation.
Infect Immun: 1999, 67(10);5427-33
[PubMed:10496925] [WorldCat.org] [DOI] (P p)Ursula Fluckiger, Martina Ulrich, Andrea Steinhuber, Gerd Döring, Dietrich Mack, Regine Landmann, Christiane Goerke, Christiane Wolz
Biofilm formation, icaADBC transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device-related infection model.
Infect Immun: 2005, 73(3);1811-9
[PubMed:15731082] [WorldCat.org] [DOI] (P p)C Heilmann, O Schweitzer, C Gerke, N Vanittanakom, D Mack, F Götz
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis.
Mol Microbiol: 1996, 20(5);1083-91
[PubMed:8809760] [WorldCat.org] [DOI] (P p)
