From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2460 [new locus tag: SA_RS14085 ]
  • pan locus tag?: SAUPAN006412000
  • symbol: icaD
  • pan gene symbol?: icaD
  • synonym:
  • product: intercellular adhesion protein D

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SA2460 [new locus tag: SA_RS14085 ]
  • symbol: icaD
  • product: intercellular adhesion protein D
  • replicon: chromosome
  • strand: +
  • coordinates: 2771699..2772004
  • length: 306
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
    GAAACAGCACTTATCGCTATATCGTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
    GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
    TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
    ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
    TCGTGA
    60
    120
    180
    240
    300
    306

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SA2460 [new locus tag: SA_RS14085 ]
  • symbol: IcaD
  • description: intercellular adhesion protein D
  • length: 101
  • theoretical pI: 5.82065
  • theoretical MW: 11782.9
  • GRAVY: 0.670297

⊟Function[edit | edit source]

  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides intracellular adhesion protein D (TIGR03932; HMM-score: 132.7)
    and 2 more
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)
    integral membrane protein (TIGR04561; HMM-score: 5)
  • TheSEED  :
    • Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaD
    Regulation and Cell signaling Quorum sensing and biofilm formation Biofilm formation in Staphylococcus  Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaD
  • PFAM:
    APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.2)
    Aa_trans; Transmembrane amino acid transporter protein (PF01490; HMM-score: 15.8)
    and 3 more
    no clan defined DUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 14.1)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 9.3)
    no clan defined DUF3671; Protein of unknown function (PF12420; HMM-score: 8)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000853
    • TAT(Tat/SPI): 0.000208
    • LIPO(Sec/SPII): 0.023432
  • predicted transmembrane helices (TMHMM): 2

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulators: CodY (repression) regulon, IcaR (repression) regulon
    CodY(TF)important in Amino acid metabolism; RegPrecise 
    IcaR(TF)important in Intercellular adhesion; RegPrecise 

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

Ursula Fluckiger, Martina Ulrich, Andrea Steinhuber, Gerd Döring, Dietrich Mack, Regine Landmann, Christiane Goerke, Christiane Wolz
Biofilm formation, icaADBC transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device-related infection model.
Infect Immun: 2005, 73(3);1811-9
[PubMed:15731082] [WorldCat.org] [DOI] (P p)C Heilmann, O Schweitzer, C Gerke, N Vanittanakom, D Mack, F Götz
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis.
Mol Microbiol: 1996, 20(5);1083-91
[PubMed:8809760] [WorldCat.org] [DOI] (P p)

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SA2460&oldid=96468"