From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0964 [new locus tag: SAUSA300_RS05185 ]
  • pan locus tag?: SAUPAN003273000
  • symbol: SAUSA300_0964
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_0964 [new locus tag: SAUSA300_RS05185 ]
  • symbol: SAUSA300_0964
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1057264..1057581
  • length: 318
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGAATAAACTATTACAGTCATTATCAGCCCTCGGTGTTTCTGCTACACTAGTAACACCA
    AATTTAAATGCAGATGCAACGACGAATACTACACCACAAATTAAAGGCGCTAATGATATC
    GTTATTAAGAAAGGTCAAGATTATAACCTTCTAAACGGCATAAGTGCATTTGATAAAGAA
    GATGGAGATTTAACCGATAAAATTAAAGTCGATGGCCAAATTGATACATCTAAATCTGGT
    AAATATCAAATTAAATATCATGTCACTGATTCAGATGGTGCAATTAAAATTTCCACTAGG
    TATATTGAGGTTAAATAG
    60
    120
    180
    240
    300
    318

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAUSA300_0964 [new locus tag: SAUSA300_RS05185 ]
  • symbol: SAUSA300_0964
  • description: hypothetical protein
  • length: 105
  • theoretical pI: 7.5126
  • theoretical MW: 11344.7
  • GRAVY: -0.431429

⊟Function[edit | edit source]

  • reaction:
    EC 3.2.1.14?  ExPASy
    Chitinase Random endo-hydrolysis of N-acetyl-beta-D-glucosaminide (1->4)-beta-linkages in chitin and chitodextrins
  • TIGRFAM:
  • TheSEED  :
    • Chitinase B
  • PFAM:
    E-set (CL0159) Bact_surface_Ig-like; Bacterial surface protein, Ig-like domain (PF16403; HMM-score: 83.3)
    and 6 more
    Big_3; Bacterial Ig-like domain (group 3) (PF07523; HMM-score: 20.9)
    CopC; CopC domain (PF04234; HMM-score: 16.7)
    Rib; Rib domain (PF08428; HMM-score: 15.9)
    no clan defined DUF7013; Domain of unknown function (DUF7013) (PF22793; HMM-score: 14.8)
    E-set (CL0159) DUF4625; Domain of unknown function (DUF4625) (PF15418; HMM-score: 14.4)
    Big_9; Bacterial Ig domain (PF17963; HMM-score: 14.4)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.0044
    • Cell wall & surface Score: 0.0159
    • Extracellular Score: 0.9796
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: -0.17
    • Signal peptide possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LNADATTN
  • SignalP: Signal peptide SP(Sec/SPI) length 26 aa
    • SP(Sec/SPI): 0.972948
    • TAT(Tat/SPI): 0.020365
    • LIPO(Sec/SPII): 0.002926
    • Cleavage Site: CS pos: 26-27. ADA-TT. Pr: 0.6096
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNKLLQSLSALGVSATLVTPNLNADATTNTTPQIKGANDIVIKKGQDYNLLNGISAFDKEDGDLTDKIKVDGQIDTSKSGKYQIKYHVTDSDGAIKISTRYIEVK

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: VraR (activation) regulon
    VraR(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [2] [3]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 1.126 1.127 1.128 1.129 1.130 1.131 1.132 1.133 1.134 1.135 1.136 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  3. ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SAUSA300_0964&oldid=84987"