Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_2192 [new locus tag: SAUSA300_RS12090 ]
- pan locus tag?: SAUPAN005690000
- symbol: rplE
- pan gene symbol?: rplE
- synonym:
- product: 50S ribosomal protein L5
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_2192 [new locus tag: SAUSA300_RS12090 ]
- symbol: rplE
- product: 50S ribosomal protein L5
- replicon: chromosome
- strand: -
- coordinates: 2364918..2365457
- length: 540
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3913235 NCBI
- RefSeq: YP_494827 NCBI
- BioCyc: see SAUSA300_RS12090
- MicrobesOnline: 1293707 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481TTGAACCGTTTAAAAGAAAAGTTTAACACTGAAGTTACTGAAAACTTAATGAAAAAATTC
AATTATAGTTCAGTAATGGAAGTACCAAAAATAGATAAAATCGTTGTGAACATGGGTGTA
GGTGACGCAGTACAAAATTCTAAAGTATTAGACAATGCTGTTGAAGAATTAGAATTGATC
ACTGGTCAAAAACCATTAGTAACTAAAGCTAAAAAATCAATCGCGACTTTCCGTTTACGT
GAAGGTATGCCAATCGGTGCGAAAGTAACACTTCGCGGTGAAAGAATGTATGAATTCTTA
GACAAATTAATTTCAGTATCATTACCACGTGTACGTGACTTCCAAGGTGTTTCTAAAAAA
GCATTTGACGGACGCGGTAACTACACTTTAGGTGTTAAAGAACAATTAATTTTCCCAGAA
ATCGACTATGATAAAGTAAGTAAAGTTAGAGGAATGGATATTGTTATCGTAACGACTGCT
AACACTGATGAAGAAGCTCGTGAATTGTTAGCTAACTTCGGTATGCCATTCCGTAAATAA60
120
180
240
300
360
420
480
540
⊟Protein[edit | edit source]
Protein Data Bank: 4WCE
Protein Data Bank: 4WF9
Protein Data Bank: 4WFA
Protein Data Bank: 4WFB
Protein Data Bank: 5HKV
Protein Data Bank: 5HL7
Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5NRG
Protein Data Bank: 5TCU
⊟General[edit | edit source]
- locus tag: SAUSA300_2192 [new locus tag: SAUSA300_RS12090 ]
- symbol: RplE
- description: 50S ribosomal protein L5
- length: 179
- theoretical pI: 9.95029
- theoretical MW: 20266.5
- GRAVY: -0.305587
⊟Function[edit | edit source]
- TIGRFAM: Energy metabolism Amino acids and amines urocanate hydratase (TIGR01228; EC 4.2.1.49; HMM-score: 10.8)
- TheSEED :
- LSU ribosomal protein L5p (L11e)
- PFAM: no clan defined Ribosomal_L5_C; ribosomal L5P family C-terminus (PF00673; HMM-score: 145.9)and 3 moreS24e_L23_L15e (CL0652) Ribosomal_L5; Ribosomal protein L5 (PF00281; HMM-score: 102.4)no clan defined DUF2660; Protein of unknown function (DUF2660) (PF10859; HMM-score: 12.9)Urocanase_N; Urocanase N-terminal domain (PF17391; HMM-score: 12.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0.0876
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0
- Extracellular Score: 0.9122
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007059
- TAT(Tat/SPI): 0.000325
- LIPO(Sec/SPII): 0.000455
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNRLKEKFNTEVTENLMKKFNYSSVMEVPKIDKIVVNMGVGDAVQNSKVLDNAVEELELITGQKPLVTKAKKSIATFRLREGMPIGAKVTLRGERMYEFLDKLISVSLPRVRDFQGVSKKAFDGRGNYTLGVKEQLIFPEIDYDKVSKVRGMDIVIVTTANTDEEARELLANFGMPFRK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAUSA300_2570 (arcA) arginine deiminase [1] (data from MRSA252) SAUSA300_1096 (carB) carbamoyl phosphate synthase large subunit [1] (data from MRSA252) SAUSA300_1540 (dnaK) molecular chaperone DnaK [1] (data from MRSA252) SAUSA300_0760 (eno) phosphopyruvate hydratase [1] (data from MRSA252) SAUSA300_0532 (fusA) elongation factor G [1] (data from MRSA252) SAUSA300_0756 (gap) glyceraldehyde-3-phosphate dehydrogenase, type I [1] (data from MRSA252) SAUSA300_1880 (gatB) aspartyl/glutamyl-tRNA amidotransferase subunit B [1] (data from MRSA252) SAUSA300_1640 (icd) isocitrate dehydrogenase [1] (data from MRSA252) SAUSA300_1330 (ilvA) threonine dehydratase [1] (data from MRSA252) SAUSA300_1730 (metK) S-adenosylmethionine synthetase [1] (data from MRSA252) SAUSA300_2541 (mqo) malate:quinone oxidoreductase [1] (data from MRSA252) SAUSA300_2089 (pdp) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) SAUSA300_0220 (pflB) formate acetyltransferase [1] (data from MRSA252) SAUSA300_1644 (pyk) pyruvate kinase [1] (data from MRSA252) SAUSA300_2203 (rplD) 50S ribosomal protein L4 [1] (data from MRSA252) SAUSA300_0524 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SAUSA300_1365 (rpsA) 30S ribosomal protein S1 [1] (data from MRSA252) SAUSA300_2198 (rpsC) 30S ribosomal protein S3 [1] (data from MRSA252) SAUSA300_1666 (rpsD) 30S ribosomal protein S4 [1] (data from MRSA252) SAUSA300_2205 (rpsJ) 30S ribosomal protein S10 [1] (data from MRSA252) SAUSA300_2179 (rpsK) 30S ribosomal protein S11 [1] (data from MRSA252) SAUSA300_0530 (rpsL) 30S ribosomal protein S12 [1] (data from MRSA252) SAUSA300_2180 (rpsM) 30S ribosomal protein S13 [1] (data from MRSA252) SAUSA300_2025 (rsbU) sigma-B regulation protein [1] (data from MRSA252) SAUSA300_1009 (typA) GTP-binding protein [1] (data from MRSA252) SAUSA300_0235 L-lactate dehydrogenase [1] (data from MRSA252) SAUSA300_0637 dihydroxyacetone kinase subunit DhaL [1] (data from MRSA252) SAUSA300_0658 LysR family transcriptional regulator [1] (data from MRSA252) SAUSA300_0716 ribonucleotide-diphosphate reductase subunit alpha [1] (data from MRSA252) SAUSA300_0844 hypothetical protein [1] (data from MRSA252) SAUSA300_0912 enoyl-(acyl carrier protein) reductase [1] (data from MRSA252) SAUSA300_2076 aldehyde dehydrogenase family protein [1] (data from MRSA252) SAUSA300_2125 ATP-binding Mrp/Nbp35 family protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: adk < secY < rplO < rpmD < rpsE < rplR < rplF < rpsH < rpsN < rplE < rplX < rplN < rpsQ < rpmC < rplP < rpsC < rplV < rpsS < rplB < rplW < rplD < rplC < rpsJ
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)