From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2227 [new locus tag: SACOL_RS11720 ]
  • pan locus tag?: SAUPAN005690000
  • symbol: rplE
  • pan gene symbol?: rplE
  • synonym:
  • product: 50S ribosomal protein L5

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2227 [new locus tag: SACOL_RS11720 ]
  • symbol: rplE
  • product: 50S ribosomal protein L5
  • replicon: chromosome
  • strand: -
  • coordinates: 2301051..2301590
  • length: 540
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    TTGAACCGTTTAAAAGAAAAGTTTAACACTGAAGTTACTGAAAACTTAATGAAAAAATTC
    AATTATAGTTCAGTAATGGAAGTACCAAAAATAGATAAAATCGTTGTGAACATGGGTGTA
    GGTGACGCAGTACAAAATTCTAAAGTATTAGACAATGCTGTTGAAGAATTAGAATTGATC
    ACTGGTCAAAAACCATTAGTAACTAAAGCTAAAAAATCAATCGCGACTTTCCGTTTACGT
    GAAGGTATGCCAATCGGTGCGAAAGTAACACTTCGCGGTGAAAGAATGTATGAATTCTTA
    GACAAATTAATTTCAGTATCATTACCACGTGTACGTGACTTCCAAGGTGTTTCTAAAAAA
    GCATTTGACGGACGCGGTAACTACACTTTAGGTGTTAAAGAACAATTAATTTTCCCAGAA
    ATCGACTATGATAAAGTAAGTAAAGTTAGAGGAATGGATATTGTTATCGTAACGACTGCT
    AACACTGATGAAGAAGCTCGTGAATTGTTAGCTAACTTCGGTATGCCATTCCGTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540

⊟Protein[edit | edit source]

Protein Data Bank: 4WCE
Protein Data Bank: 4WF9
Protein Data Bank: 4WFA
Protein Data Bank: 4WFB
Protein Data Bank: 5HKV
Protein Data Bank: 5HL7
Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5NRG
Protein Data Bank: 5TCU

⊟General[edit | edit source]

  • locus tag: SACOL2227 [new locus tag: SACOL_RS11720 ]
  • symbol: RplE
  • description: 50S ribosomal protein L5
  • length: 179
  • theoretical pI: 9.95029
  • theoretical MW: 20266.5
  • GRAVY: -0.305587

⊟Function[edit | edit source]

  • TIGRFAM:
    Metabolism Energy metabolism Amino acids and amines urocanate hydratase (TIGR01228; EC 4.2.1.49; HMM-score: 10.8)
  • TheSEED  :
    • LSU ribosomal protein L5p (L11e)
    Protein Metabolism Protein biosynthesis Ribosome LSU bacterial  LSU ribosomal protein L5p (L11e)
  • PFAM:
    no clan defined Ribosomal_L5_C; ribosomal L5P family C-terminus (PF00673; HMM-score: 142.8)
    and 3 more
    S24e_L23_L15e (CL0652) Ribosomal_L5; Ribosomal protein L5 (PF00281; HMM-score: 100.3)
    no clan defined Urocanase_N; Urocanase N-terminal domain (PF17391; HMM-score: 14.7)
    DUF2660; Protein of unknown function (DUF2660) (PF10859; HMM-score: 13.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007059
    • TAT(Tat/SPI): 0.000325
    • LIPO(Sec/SPII): 0.000455
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNRLKEKFNTEVTENLMKKFNYSSVMEVPKIDKIVVNMGVGDAVQNSKVLDNAVEELELITGQKPLVTKAKKSIATFRLREGMPIGAKVTLRGERMYEFLDKLISVSLPRVRDFQGVSKKAFDGRGNYTLGVKEQLIFPEIDYDKVSKVRGMDIVIVTTANTDEEARELLANFGMPFRK

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3] [4]
  • quantitative data / protein copy number per cell: 5400 [5]
  • interaction partners:
    SACOL2657(arcA)arginine deiminase  [6] (data from MRSA252)
    SACOL1215(carB)carbamoyl phosphate synthase large subunit  [6] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [6] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [6] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [6] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [6] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [6] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [6] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [6] (data from MRSA252)
    SACOL1477(ilvA1)threonine dehydratase  [6] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [6] (data from MRSA252)
    SACOL1837(metK)S-adenosylmethionine synthetase  [6] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [6] (data from MRSA252)
    SACOL0792(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [6] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [6] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [6] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [6] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [6] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [6] (data from MRSA252)
    SACOL1516(rpsA)30S ribosomal protein S1  [6] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [6] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [6] (data from MRSA252)
    SACOL2240(rpsJ)30S ribosomal protein S10  [6] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [6] (data from MRSA252)
    SACOL0591(rpsL)30S ribosomal protein S12  [6] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [6] (data from MRSA252)
    SACOL2057(rsbU)sigma factor B regulator protein  [6] (data from MRSA252)
    SACOL1118(typA)GTP-binding protein TypA  [6] (data from MRSA252)
    SACOL0708DAK2 domain-containing protein  [6] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [6] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [6] (data from MRSA252)
    SACOL2114aldehyde dehydrogenase  [6] (data from MRSA252)
    SACOL2156ATP-binding Mrp/Nbp35 family protein  [6] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: 12.76 h [7]

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 6.15 6.16 6.17 6.18 6.19 6.20 6.21 6.22 6.23 6.24 6.25 6.26 6.27 6.28 6.29 6.30 6.31 6.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  7. ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SACOL2227&oldid=96726"