From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2657 [new locus tag: SACOL_RS13915 ]
  • pan locus tag?: SAUPAN006364000
  • symbol: arcA
  • pan gene symbol?: arcA
  • synonym:
  • product: arginine deiminase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2657 [new locus tag: SACOL_RS13915 ]
  • symbol: arcA
  • product: arginine deiminase
  • replicon: chromosome
  • strand: -
  • coordinates: 2718452..2719687
  • length: 1236
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGACAGATGGTCCAATTAAAGTAAATAGCGAAATTGGAGCTTTAAAAACTGTGTTACTT
    AAGCGTCCTGGAAAAGAATTAGAAAATTTAGTACCTGATTATTTAGATGGATTACTATTT
    GATGATATTCCATATTTAGAAGTAGCTCAAAAAGAGCATGACCATTTTGCGCAGGTGCTA
    AGAGAAGAGGGTGTTGAAGTACTTTACCTTGAGAAGTTAGCAGCTGAAAGTATTGAAAAT
    CCTCAAGTAAGAAGTGAATTTATTGATGATGTATTAGCAGAGTCTAAAAAAACAATATTA
    GGTCATGAAGAAGAAATTAAGGCATTATTTGCGACACTTTCTAATCAAGAACTTGTAGAT
    AAAATAATGTCAGGGGTACGTAAGGAAGAAATTAATCCGAAATGTACACATCTAGTAGAG
    TATATGGATGATAAGTATCCATTCTATTTAGATCCAATGCCAAACCTTTATTTTACTAGA
    GATCCACAAGCCTCAATAGGACACGGTATAACAATCAATCGGATGTTCTGGAGAGCACGA
    CGACGAGAATCAATATTTATTCAATATATTGTAAAGCATCATCCTAGATTTAAAGATGCG
    AATATTCCAATCTGGTTAGATCGAGATTGCCCATTCAATATTGAAGGCGGCGATGAACTT
    GTTTTATCTAAAGATGTCTTGGCTATAGGCGTTTCAGAACGTACATCTGCACAAGCTATT
    GAAAAGTTAGCGCGACGTATTTTTGAAAATCCGCAGGCGACGTTTAAAAAAGTAGTAGCA
    ATTGAAATTCCAACTAGTCGAACTTTTATGCACTTAGATACAGTATTTACAATGATAGAT
    TATGACAAATTTACAATGCATTCAGCCATTTTAAAGGCAGAAGGCAATATGAATATATTT
    ATTATTGAATATGATGACGTAAATAAAGATATTGCCATCAAACAATCTAGTCATTTAAAA
    GATACTTTAGAAGACGTACTAGGTATAGATGATATCCAATTCATTCCAACAGGAAATGGT
    GATGTCATTGATGGTGCTAGAGAGCAATGGAATGATGGCTCAAATACATTATGTATAAGA
    CCAGGCGTTGTAGTGACTTACGATAGAAACTATGTATCGAATGATTTATTGAGACAAAAA
    GGCATTAAAGTCATTGAAATATCTGGTAGCGAGTTGGTACGTGGACGTGGGGGCCCTAGA
    TGTATGAGTCAACCATTATTCAGAGAAGACATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1236

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2657 [new locus tag: SACOL_RS13915 ]
  • symbol: ArcA
  • description: arginine deiminase
  • length: 411
  • theoretical pI: 4.87271
  • theoretical MW: 46914.3
  • GRAVY: -0.310706

Function[edit | edit source]

  • reaction:
    EC 3.5.3.6?  ExPASy
    Arginine deiminase L-arginine + H2O = L-citrulline + NH3
  • TIGRFAM:
    Metabolism Energy metabolism Amino acids and amines arginine deiminase (TIGR01078; EC 3.5.3.6; HMM-score: 544.2)
  • TheSEED  :
    • Arginine deiminase (EC 3.5.3.6)
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine and Ornithine Degradation  Arginine deiminase (EC 3.5.3.6)
    and 1 more
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine Deiminase Pathway  Arginine deiminase (EC 3.5.3.6)
  • PFAM:
    GME (CL0197) ADI; Arginine deiminase (PF02274; HMM-score: 529.9)
    and 1 more
    DDAH_eukar; N,N dimethylarginine dimethylhydrolase, eukaryotic (PF19420; HMM-score: 37)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.8828
    • Cytoplasmic Membrane Score: 0.0338
    • Cell wall & surface Score: 0.0004
    • Extracellular Score: 0.083
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001529
    • TAT(Tat/SPI): 0.000088
    • LIPO(Sec/SPII): 0.000227
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTDGPIKVNSEIGALKTVLLKRPGKELENLVPDYLDGLLFDDIPYLEVAQKEHDHFAQVLREEGVEVLYLEKLAAESIENPQVRSEFIDDVLAESKKTILGHEEEIKALFATLSNQELVDKIMSGVRKEEINPKCTHLVEYMDDKYPFYLDPMPNLYFTRDPQASIGHGITINRMFWRARRRESIFIQYIVKHHPRFKDANIPIWLDRDCPFNIEGGDELVLSKDVLAIGVSERTSAQAIEKLARRIFENPQATFKKVVAIEIPTSRTFMHLDTVFTMIDYDKFTMHSAILKAEGNMNIFIIEYDDVNKDIAIKQSSHLKDTLEDVLGIDDIQFIPTGNGDVIDGAREQWNDGSNTLCIRPGVVVTYDRNYVSNDLLRQKGIKVIEISGSELVRGRGGPRCMSQPLFREDI

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:
    SACOL1673(alaS)alanyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL0816(secA)preprotein translocase subunit SecA  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL0742hypothetical protein  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: Rex* (repression) regulon, ArcR* (activation) regulon, ArgR/AhrC (repression) regulon, CcpA regulon
    Rex*(TF)important in Energy metabolism; RegPrecise 
    ArcR*(TF)important in Arginine degradation; RegPrecise 
    ArgR/AhrC(TF)important in Arginine biosynthesis, Arginine degradation; RegPrecise 
    CcpA(TF)important in Carbon catabolism; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]