Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2035 [new locus tag: SACOL_RS10620 ]
- pan locus tag?: SAUPAN005291000
- symbol: SACOL2035
- pan gene symbol?: rex
- synonym:
- product: redox-sensing transcriptional repressor Rex
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2035 [new locus tag: SACOL_RS10620 ]
- symbol: SACOL2035
- product: redox-sensing transcriptional repressor Rex
- replicon: chromosome
- strand: -
- coordinates: 2093109..2093744
- length: 636
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236155 NCBI
- RefSeq: YP_186852 NCBI
- BioCyc: see SACOL_RS10620
- MicrobesOnline: 913508 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGAGTGACCAAGTTAAAATTCCTCGAGCAACTTTAAAACGTTTGCCGTTATATTATAGA
TTTGTCAGTTCATTAAAATCTAAAGGTATAGATCGTGTAAATTCAAAAGCGATTAGCGAT
GCGTTACAAATTGACTCGGCAACAATTCGTCGTGACTTTTCATATTTTGGCGAATTAGGT
AAAAAAGGGTACGGATATAATATAGATAGTTTATTGGATTTCTTTAAATCTGAACTAAGC
GAGAGTGACATGATCAAAATCGCAATTGTCGGAGTTGGGAACCTAGGGAAAGCTTTGCTC
ACATATAACTTTTCAATACATGACGATATGACGATTACAGAAGCGTTTGACGTAAAAGAA
GATGTTATTGGCCAGAAAATAGGGAACGTTATTGTTAAAGATAACGATGAATTAATAACA
ACATTGAAGAAGGAAGAAATAGATGTTGTGATTCTAACTACACCAGAAAGAGTTGCACAG
AAAGTTGCAGATGAACTCGTCCAAGCTGGTGTGAAAGGTATTTTAAACTTCACTCCTGGT
AGAATTAATACGCCTTCAGATGTGCAAGTACATCAAATTGACTTAGGTATAGAATTACAG
TCATTATTATTCTTTATGAAAAATTACAGTGAATAA60
120
180
240
300
360
420
480
540
600
636
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2035 [new locus tag: SACOL_RS10620 ]
- symbol: SACOL2035
- description: redox-sensing transcriptional repressor Rex
- length: 211
- theoretical pI: 5.12384
- theoretical MW: 23598.9
- GRAVY: -0.0995261
⊟Function[edit | edit source]
- TIGRFAM: diaminopimelate dehydrogenase (TIGR01921; EC 1.4.1.16; HMM-score: 21.3)Amino acid biosynthesis Glutamate family N-acetyl-gamma-glutamyl-phosphate reductase (TIGR01850; EC 1.2.1.38; HMM-score: 19.5)Amino acid biosynthesis Aspartate family 4-hydroxy-tetrahydrodipicolinate reductase (TIGR00036; EC 1.17.1.8; HMM-score: 17.4)Energy metabolism Sugars inositol 2-dehydrogenase (TIGR04380; EC 1.1.1.18; HMM-score: 17.3)and 7 moresugar O-acyltransferase, sialic acid O-acetyltransferase NeuD family (TIGR03570; HMM-score: 15.8)Amino acid biosynthesis Glutamate family pyrroline-5-carboxylate reductase (TIGR00112; EC 1.5.1.2; HMM-score: 14.8)acetaldehyde dehydrogenase (acetylating) (TIGR03215; EC 1.2.1.10; HMM-score: 14.2)acetyl coenzyme A synthetase (ADP forming), alpha domain (TIGR02717; EC 6.2.1.13; HMM-score: 14.1)undecaprenyl-phosphate glucose phosphotransferase (TIGR03023; EC 2.7.8.-; HMM-score: 13.7)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides cellulose synthase operon protein YhjU (TIGR03368; HMM-score: 12.2)exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase (TIGR03025; HMM-score: 12)
- TheSEED :
- Redox-sensing transcriptional repressor Rex
- PFAM: NADP_Rossmann (CL0063) CoA_binding; CoA binding domain (PF02629; HMM-score: 92.3)and 9 moreHTH (CL0123) Put_DNA-bind_N; Putative DNA-binding protein N-terminus (PF06971; HMM-score: 69.5)NADP_Rossmann (CL0063) Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 24)GFO_IDH_MocA; Oxidoreductase family, NAD-binding Rossmann fold (PF01408; HMM-score: 22.9)F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 18.7)GARS_N; Phosphoribosylglycinamide synthetase, N domain (PF02844; HMM-score: 15.7)HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 15.6)NADP_Rossmann (CL0063) CoA_binding_2; CoA binding domain (PF13380; HMM-score: 15.5)no clan defined Packaging_FI; DNA packaging protein FI (PF14000; HMM-score: 15.5)MTD; methylene-5,6,7,8-tetrahydromethanopterin dehydrogenase (PF01993; HMM-score: 12.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effector: NADH
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9836
- Cytoplasmic Membrane Score: 0.0072
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.009
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.007572
- TAT(Tat/SPI): 0.000828
- LIPO(Sec/SPII): 0.001442
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSDQVKIPRATLKRLPLYYRFVSSLKSKGIDRVNSKAISDALQIDSATIRRDFSYFGELGKKGYGYNIDSLLDFFKSELSESDMIKIAIVGVGNLGKALLTYNFSIHDDMTITEAFDVKEDVIGQKIGNVIVKDNDELITTLKKEEIDVVILTTPERVAQKVADELVQAGVKGILNFTPGRINTPSDVQVHQIDLGIELQSLLFFMKNYSE
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 242 [4]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: 32.56 h [5]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Martin Pagels, Stephan Fuchs, Jan Pané-Farré, Christian Kohler, Leonhard Menschner, Michael Hecker, Peter J McNamarra, Mikael C Bauer, Claes von Wachenfeldt, Manuel Liebeke, Michael Lalk, Gunnar Sander, Christof von Eiff, Richard A Proctor, Susanne Engelmann
Redox sensing by a Rex-family repressor is involved in the regulation of anaerobic gene expression in Staphylococcus aureus.
Mol Microbiol: 2010, 76(5);1142-61
[PubMed:20374494] [WorldCat.org] [DOI] (I p)