From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0731 [new locus tag: SACOL_RS03755 ]
  • pan locus tag?: SAUPAN002554000
  • symbol: SACOL0731
  • pan gene symbol?: ccpE
  • synonym:
  • product: LysR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0731 [new locus tag: SACOL_RS03755 ]
  • symbol: SACOL0731
  • product: LysR family transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 755578..756444
  • length: 867
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAAGATTGAAGACTATCGTTTACTAATAACATTAGACGAAACGAAAACGTTACGTAAA
    GCGGCTGAAATTTTATATATATCTCAACCTGCTGTTACACAAAGACTAAAAGCTATTGAA
    AATGCTTTTGGAGTAGATATTTTTATCAGAACAAAAAAACAATTGATTACAACAACTGAA
    GGAACAATGATTATTGAGCATGCTCGTGACATGTTGAAAAGAGAGCGATTATTTTTTGAC
    AAAATGCAGGCACATATTGGTGAAGTGAATGGAACAATATCAATCGGGTGTTCTTCTTTG
    ATTGGACAAACCTTACTTCCTGAAGTTTTGAGCCTATATAATGCCCAATTTCCTAATGTT
    GAAATACAAGTGCAAGTTGGTTCAACTGAACAAATTAAAGCAAATCATAGAGATTATCAT
    GTTATGATAACTCGTGGAAATAAGGTAATGAATTTAGCTAACACACATTTATTTAATGAT
    GATCATTATTTTATTTTTCCAAAAAATAGACGAGATGATGTTACAAAGTTACCATTTATA
    GAGTTTCAAGCTGATCCGATTTATATAAATCAAATAAAAGAATGGTATAACGATAATTTA
    GAACAAGATTACCATGCAACTATTACAGTGGATCAAGTAGCAACTTGCAAAGAAATGTTG
    ATTAGTGGTGTAGGTGTTACAATCTTGCCAGAAATTATGATGAAAAATATCAGCAAAGAA
    CAATTTGAGTTTGAAAAAGTAGAAATTGATAATGAACCGCTGATTCGTTCGACATTTATG
    AGTTATGATCCGAGCATGTTGCAATTGCCACAAGTTGATTCTTTTGTAAATCTCATGGCG
    AGCTTTGTTGAACAACCAAAGGCGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    867

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0731 [new locus tag: SACOL_RS03755 ]
  • symbol: SACOL0731
  • description: LysR family transcriptional regulator
  • length: 288
  • theoretical pI: 5.22005
  • theoretical MW: 33244.1
  • GRAVY: -0.219097

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions aminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 74.4)
    and 7 more
    Metabolism Energy metabolism Other pca operon transcription factor PcaQ (TIGR02424; HMM-score: 54.4)
    Signal transduction Regulatory functions DNA interactions pca operon transcription factor PcaQ (TIGR02424; HMM-score: 54.4)
    Cellular processes Cellular processes Toxin production and resistance transcriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair transcriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)
    Signal transduction Regulatory functions DNA interactions transcriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)
    putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 41.2)
    Signal transduction Regulatory functions DNA interactions D-serine deaminase transcriptional activator (TIGR02036; HMM-score: 33)
  • TheSEED  :
    • LysR family transcriptional regulator
  • PFAM:
    PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 91)
    and 5 more
    HTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 54.6)
    HTH_30; PucR C-terminal helix-turn-helix domain (PF13556; HMM-score: 18.9)
    no clan defined DUF5864; Family of unknown function (DUF5864) (PF19182; HMM-score: 16.5)
    DUF1433; Protein of unknown function (DUF1433) (PF07252; HMM-score: 15.4)
    KH (CL0007) KH_BICC1; Protein bicaudal C homolog 1, KH-like domain (PF22985; HMM-score: 12.4)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9961
    • Cytoplasmic Membrane Score: 0.0028
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0011
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003248
    • TAT(Tat/SPI): 0.000242
    • LIPO(Sec/SPII): 0.000327
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKIEDYRLLITLDETKTLRKAAEILYISQPAVTQRLKAIENAFGVDIFIRTKKQLITTTEGTMIIEHARDMLKRERLFFDKMQAHIGEVNGTISIGCSSLIGQTLLPEVLSLYNAQFPNVEIQVQVGSTEQIKANHRDYHVMITRGNKVMNLANTHLFNDDHYFIFPKNRRDDVTKLPFIEFQADPIYINQIKEWYNDNLEQDYHATITVDQVATCKEMLISGVGVTILPEIMMKNISKEQFEFEKVEIDNEPLIRSTFMSYDPSMLQLPQVDSFVNLMASFVEQPKA

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 45 [4]
  • interaction partners:
    SACOL2657(arcA)arginine deiminase  [5] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [5] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [5] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [5] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [5] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [5] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [5] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [5] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [5] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [5] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [5] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [5] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [5] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [5] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [5] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [5] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [5] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [5] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [5] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [5] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [5] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [5] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [5] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [5] (data from MRSA252)
    SACOL1759universal stress protein  [5] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [5] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]