Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0731 [new locus tag: SACOL_RS03755 ]
- pan locus tag?: SAUPAN002554000
- symbol: SACOL0731
- pan gene symbol?: ccpE
- synonym:
- product: LysR family transcriptional regulator
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0731 [new locus tag: SACOL_RS03755 ]
- symbol: SACOL0731
- product: LysR family transcriptional regulator
- replicon: chromosome
- strand: +
- coordinates: 755578..756444
- length: 867
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236059 NCBI
- RefSeq: YP_185611 NCBI
- BioCyc: see SACOL_RS03755
- MicrobesOnline: 912207 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGAAGATTGAAGACTATCGTTTACTAATAACATTAGACGAAACGAAAACGTTACGTAAA
GCGGCTGAAATTTTATATATATCTCAACCTGCTGTTACACAAAGACTAAAAGCTATTGAA
AATGCTTTTGGAGTAGATATTTTTATCAGAACAAAAAAACAATTGATTACAACAACTGAA
GGAACAATGATTATTGAGCATGCTCGTGACATGTTGAAAAGAGAGCGATTATTTTTTGAC
AAAATGCAGGCACATATTGGTGAAGTGAATGGAACAATATCAATCGGGTGTTCTTCTTTG
ATTGGACAAACCTTACTTCCTGAAGTTTTGAGCCTATATAATGCCCAATTTCCTAATGTT
GAAATACAAGTGCAAGTTGGTTCAACTGAACAAATTAAAGCAAATCATAGAGATTATCAT
GTTATGATAACTCGTGGAAATAAGGTAATGAATTTAGCTAACACACATTTATTTAATGAT
GATCATTATTTTATTTTTCCAAAAAATAGACGAGATGATGTTACAAAGTTACCATTTATA
GAGTTTCAAGCTGATCCGATTTATATAAATCAAATAAAAGAATGGTATAACGATAATTTA
GAACAAGATTACCATGCAACTATTACAGTGGATCAAGTAGCAACTTGCAAAGAAATGTTG
ATTAGTGGTGTAGGTGTTACAATCTTGCCAGAAATTATGATGAAAAATATCAGCAAAGAA
CAATTTGAGTTTGAAAAAGTAGAAATTGATAATGAACCGCTGATTCGTTCGACATTTATG
AGTTATGATCCGAGCATGTTGCAATTGCCACAAGTTGATTCTTTTGTAAATCTCATGGCG
AGCTTTGTTGAACAACCAAAGGCGTAG60
120
180
240
300
360
420
480
540
600
660
720
780
840
867
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0731 [new locus tag: SACOL_RS03755 ]
- symbol: SACOL0731
- description: LysR family transcriptional regulator
- length: 288
- theoretical pI: 5.22005
- theoretical MW: 33244.1
- GRAVY: -0.219097
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions aminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 74.4)and 7 moreEnergy metabolism Other pca operon transcription factor PcaQ (TIGR02424; HMM-score: 54.4)Regulatory functions DNA interactions pca operon transcription factor PcaQ (TIGR02424; HMM-score: 54.4)Cellular processes Toxin production and resistance transcriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)DNA metabolism DNA replication, recombination, and repair transcriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)Regulatory functions DNA interactions transcriptional regulator, ArgP family (TIGR03298; HMM-score: 46.9)putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 41.2)Regulatory functions DNA interactions D-serine deaminase transcriptional activator (TIGR02036; HMM-score: 33)
- TheSEED :
- LysR family transcriptional regulator
- PFAM: PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 91)and 5 moreHTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 54.6)HTH_30; PucR C-terminal helix-turn-helix domain (PF13556; HMM-score: 18.9)no clan defined DUF5864; Family of unknown function (DUF5864) (PF19182; HMM-score: 16.5)DUF1433; Protein of unknown function (DUF1433) (PF07252; HMM-score: 15.4)KH (CL0007) KH_BICC1; Protein bicaudal C homolog 1, KH-like domain (PF22985; HMM-score: 12.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9961
- Cytoplasmic Membrane Score: 0.0028
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0011
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003248
- TAT(Tat/SPI): 0.000242
- LIPO(Sec/SPII): 0.000327
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKIEDYRLLITLDETKTLRKAAEILYISQPAVTQRLKAIENAFGVDIFIRTKKQLITTTEGTMIIEHARDMLKRERLFFDKMQAHIGEVNGTISIGCSSLIGQTLLPEVLSLYNAQFPNVEIQVQVGSTEQIKANHRDYHVMITRGNKVMNLANTHLFNDDHYFIFPKNRRDDVTKLPFIEFQADPIYINQIKEWYNDNLEQDYHATITVDQVATCKEMLISGVGVTILPEIMMKNISKEQFEFEKVEIDNEPLIRSTFMSYDPSMLQLPQVDSFVNLMASFVEQPKA
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 45 [4]
- interaction partners:
SACOL2657 (arcA) arginine deiminase [5] (data from MRSA252) SACOL0593 (fusA) elongation factor G [5] (data from MRSA252) SACOL2623 (mqo2) malate:quinone oxidoreductase [5] (data from MRSA252) SACOL1102 (pdhA) pyruvate dehydrogenase complex E1 component subunit alpha [5] (data from MRSA252) SACOL1103 (pdhB) pyruvate dehydrogenase complex E1 component subunit beta [5] (data from MRSA252) SACOL1105 (pdhD) dihydrolipoamide dehydrogenase [5] (data from MRSA252) SACOL0204 (pflB) formate acetyltransferase [5] (data from MRSA252) SACOL1745 (pyk) pyruvate kinase [5] (data from MRSA252) SACOL2236 (rplB) 50S ribosomal protein L2 [5] (data from MRSA252) SACOL2238 (rplD) 50S ribosomal protein L4 [5] (data from MRSA252) SACOL2224 (rplF) 50S ribosomal protein L6 [5] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [5] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [5] (data from MRSA252) SACOL1725 (rplT) 50S ribosomal protein L20 [5] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [5] (data from MRSA252) SACOL2237 (rplW) 50S ribosomal protein L23 [5] (data from MRSA252) SACOL1274 (rpsB) 30S ribosomal protein S2 [5] (data from MRSA252) SACOL2233 (rpsC) 30S ribosomal protein S3 [5] (data from MRSA252) SACOL1769 (rpsD) 30S ribosomal protein S4 [5] (data from MRSA252) SACOL2222 (rpsE) 30S ribosomal protein S5 [5] (data from MRSA252) SACOL2214 (rpsK) 30S ribosomal protein S11 [5] (data from MRSA252) SACOL2230 (rpsQ) 30S ribosomal protein S17 [5] (data from MRSA252) SACOL1448 (sucB) dihydrolipoamide succinyltransferase [5] (data from MRSA252) SACOL0594 (tuf) elongation factor Tu [5] (data from MRSA252) SACOL1759 universal stress protein [5] (data from MRSA252) SACOL2173 alkaline shock protein 23 [5] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)
