From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0838 [new locus tag: SACOL_RS04310 ]
  • pan locus tag?: SAUPAN002706000
  • symbol: gapA1
  • pan gene symbol?: gapA
  • synonym:
  • product: glyceraldehyde 3-phosphate dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0838 [new locus tag: SACOL_RS04310 ]
  • symbol: gapA1
  • product: glyceraldehyde 3-phosphate dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 864842..865852
  • length: 1011
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGGCAGTAAAAGTAGCAATTAATGGTTTTGGTAGAATTGGTCGTTTAGCATTCAGAAGA
    ATTCAAGAAGTAGAAGGTCTTGAAGTTGTAGCAGTAAACGACTTAACAGATGACGACATG
    TTAGCGCATTTATTAAAATATGACACTATGCAAGGTCGTTTCACAGGTGAAGTAGAGGTA
    GTTGATGGTGGTTTCCGCGTAAATGGTAAAGAAGTTAAATCATTCAGTGAACCAGATGCA
    AGCAAATTACCTTGGAAAGACTTAAATATCGATGTAGTATTAGAATGTACTGGTTTCTAC
    ACTGATAAAGATAAAGCACAAGCTCATATTGAAGCAGGCGCTAAAAAAGTATTAATCTCA
    GCACCAGCTACTGGTGACTTAAAAACAATCGTATTCAACACTAACCACCAAGAGTTAGAC
    GGTTCTGAAACAGTTGTTTCAGGTGCTTCATGTACTACAAACTCATTAGCACCAGTTGCT
    AAAGTTTTAAACGATGACTTTGGTTTAGTTGAAGGTTTAATGACTACAATTCACGCTTAC
    ACAGGTGATCAAAATACACAAGACGCACCTCACAGAAAAGGTGACAAACGTCGTGCTCGT
    GCAGCGGCAGAAAACATCATCCCTAACTCAACAGGTGCTGCTAAAGCTATCGGTAAAGTT
    ATTCCTGAAATCGATGGTAAATTAGATGGTGGTGCACAACGTGTTCCTGTAGCTACAGGT
    TCATTAACTGAATTAACAGTAGTATTAGAAAAACAAGACGTAACAGTTGAACAAGTTAAC
    GAAGCTATGAAAAATGCTTCAAACGAATCATTCGGTTACACTGAAGACGAAATCGTTTCT
    TCAGACGTTGTAGGTATGACTTACGGTTCATTATTCGACGCTACACAAACTCGTGTAATG
    TCAGTTGGCGACCGTCAATTAGTTAAAGTTGCAGCTTGGTATGATAACGAAATGTCATAT
    ACTGCACAATTAGTTCGTACATTAGCATACTTAGCTGAACTTTCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1011

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0838 [new locus tag: SACOL_RS04310 ]
  • symbol: GapA1
  • description: glyceraldehyde 3-phosphate dehydrogenase
  • length: 336
  • theoretical pI: 4.64965
  • theoretical MW: 36280.6
  • GRAVY: -0.218155

Function[edit | edit source]

  • reaction:
    EC 1.2.1.12?  ExPASy
    Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) D-glyceraldehyde 3-phosphate + phosphate + NAD+ = 3-phospho-D-glyceroyl phosphate + NADH
  • TIGRFAM:
    Metabolism Energy metabolism Glycolysis/gluconeogenesis glyceraldehyde-3-phosphate dehydrogenase, type I (TIGR01534; EC 1.2.1.-; HMM-score: 435.2)
    and 3 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine erythrose-4-phosphate dehydrogenase (TIGR01532; EC 1.2.1.72; HMM-score: 283.8)
    Metabolism Amino acid biosynthesis Aspartate family aspartate-semialdehyde dehydrogenase (TIGR01296; EC 1.2.1.11; HMM-score: 14.4)
    Metabolism Amino acid biosynthesis Aspartate family aspartate-semialdehyde dehydrogenase (TIGR00978; EC 1.2.1.11; HMM-score: 13.4)
  • TheSEED  :
    • Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12)
    Carbohydrates Central carbohydrate metabolism Glycolysis and Gluconeogenesis  NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
    and 3 more
    Cofactors, Vitamins, Prosthetic Groups, Pigments Pyridoxine Pyridoxin (Vitamin B6) Biosynthesis  NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
    Stress Response Oxidative stress Glutaredoxins  NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
    Stress Response Oxidative stress Redox-dependent regulation of nucleus processes  NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
  • PFAM:
    GADPH_aa-bio_dh (CL0139) Gp_dh_C; Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain (PF02800; HMM-score: 198.8)
    and 5 more
    NADP_Rossmann (CL0063) Gp_dh_N; Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain (PF00044; HMM-score: 127.7)
    DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 17.3)
    GADPH_aa-bio_dh (CL0139) Semialdhyde_dhC; Semialdehyde dehydrogenase, dimerisation domain (PF02774; HMM-score: 15.2)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 11.9)
    no clan defined EF1_GNE; EF-1 guanine nucleotide exchange domain (PF00736; HMM-score: 11.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9168
    • Cytoplasmic Membrane Score: 0.0005
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0827
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002695
    • TAT(Tat/SPI): 0.000131
    • LIPO(Sec/SPII): 0.000272
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAVKVAINGFGRIGRLAFRRIQEVEGLEVVAVNDLTDDDMLAHLLKYDTMQGRFTGEVEVVDGGFRVNGKEVKSFSEPDASKLPWKDLNIDVVLECTGFYTDKDKAQAHIEAGAKKVLISAPATGDLKTIVFNTNHQELDGSETVVSGASCTTNSLAPVAKVLNDDFGLVEGLMTTIHAYTGDQNTQDAPHRKGDKRRARAAAENIIPNSTGAAKAIGKVIPEIDGKLDGGAQRVPVATGSLTELTVVLEKQDVTVEQVNEAMKNASNESFGYTEDEIVSSDVVGMTYGSLFDATQTRVMSVGDRQLVKVAAWYDNEMSYTAQLVRTLAYLAELSK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3] [4] [5]
  • quantitative data / protein copy number per cell: 16129 [6]
  • interaction partners:
    SACOL0833(clpP)ATP-dependent Clp protease proteolytic subunit  [7] (data from MRSA252)
    SACOL2130(deoD)purine nucleoside phosphorylase  [7] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [7] (data from MRSA252)
    SACOL1245(fabG1)3-oxoacyl-ACP reductase  [7] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [7] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [7] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [7] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [7] (data from MRSA252)
    SACOL1011(ppnK)inorganic polyphosphate/ATP-NAD kinase  [7] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [7] (data from MRSA252)
    SACOL1831(tal)translaldolase  [7] (data from MRSA252)
    SACOL02123-hydroxyacyl-CoA dehydrogenase  [7] (data from MRSA252)
    SACOL2163hypothetical protein  [7] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator: GapR (repression) regulon
    GapR(TF)important in Glycolysis; RegPrecise    transcription unit transferred from N315 data RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 22.69 h [8]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Annette Dreisbach, Kristina Hempel, Girbe Buist, Michael Hecker, Dörte Becher, Jan Maarten van Dijl
    Profiling the surfacome of Staphylococcus aureus.
    Proteomics: 2010, 10(17);3082-96
    [PubMed:20662103] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  6. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  7. 7.00 7.01 7.02 7.03 7.04 7.05 7.06 7.07 7.08 7.09 7.10 7.11 7.12 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  8. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]