From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2180 [new locus tag: SAUSA300_RS12030 ]
  • pan locus tag?: SAUPAN005678000
  • symbol: rpsM
  • pan gene symbol?: rpsM
  • synonym:
  • product: 30S ribosomal protein S13

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_2180 [new locus tag: SAUSA300_RS12030 ]
  • symbol: rpsM
  • product: 30S ribosomal protein S13
  • replicon: chromosome
  • strand: -
  • coordinates: 2359255..2359620
  • length: 366
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGCACGTATTGCAGGAGTAGATATTCCACGTGAAAAACGCGTAGTTATCTCATTAACT
    TATATATACGGTATCGGTACGTCAACTGCTCAAAAAATTCTTGAAGAAGCTAACGTATCA
    GCTGATACTCGTGTGAAAGATTTAACTGATGACGAATTAGGTCGCATCCGTGAAGTTGTA
    GACGGTTATAAAGTCGAAGGTGACTTACGTCGTGAAACTAACTTAAATATCAAACGTTTA
    ATGGAAATTTCATCATACCGTGGTATCCGTCACCGTCGTGGTTTACCAGTTCGTGGTCAA
    AAAACGAAAAACAACGCGCGTACTCGTAAAGGACCAGTTAAAACGGTAGCTAACAAGAAA
    AAATAA
    60
    120
    180
    240
    300
    360
    366

⊟Protein[edit | edit source]

Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5TCU

⊟General[edit | edit source]

  • locus tag: SAUSA300_2180 [new locus tag: SAUSA300_RS12030 ]
  • symbol: RpsM
  • description: 30S ribosomal protein S13
  • length: 121
  • theoretical pI: 11.0712
  • theoretical MW: 13718.7
  • GRAVY: -0.733884

⊟Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS13 (TIGR03631; HMM-score: 177.1)
    and 1 more
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS13 (TIGR03629; HMM-score: 76.4)
  • TheSEED  :
    • SSU ribosomal protein S13p (S18e)
    Protein Metabolism Protein biosynthesis Ribosome SSU bacterial  SSU ribosomal protein S13p (S18e)
  • PFAM:
    H2TH (CL0303) Ribosomal_S13; Ribosomal protein S13/S18 (PF00416; HMM-score: 121.7)
    and 3 more
    HHH (CL0198) HHH_6; Helix-hairpin-helix motif (PF14579; HMM-score: 14)
    H2TH (CL0303) FbpA; Fibronectin-binding protein A N-terminus (FbpA) (PF05833; HMM-score: 13.7)
    HHH (CL0198) DNA_pol_lambd_f; Fingers domain of DNA polymerase lambda (PF10391; HMM-score: 12.2)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.116633
    • TAT(Tat/SPI): 0.010366
    • LIPO(Sec/SPII): 0.006245
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MARIAGVDIPREKRVVISLTYIYGIGTSTAQKILEEANVSADTRVKDLTDDELGRIREVVDGYKVEGDLRRETNLNIKRLMEISSYRGIRHRRGLPVRGQKTKNNARTRKGPVKTVANKKK

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SAUSA300_2180&oldid=59974"