Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS05395 [old locus tag: NWMN_0962 ]
- pan locus tag?: SAUPAN003320000
- symbol: NWMN_RS05395
- pan gene symbol?: pdhD
- synonym: lpdA
- product: dihydrolipoyl dehydrogenase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS05395 [old locus tag: NWMN_0962 ]
- symbol: NWMN_RS05395
- product: dihydrolipoyl dehydrogenase
- replicon: chromosome
- strand: +
- coordinates: 1068597..1070003
- length: 1407
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381ATGGTAGTTGGAGATTTCCCAATTGAAACAGATACTATAGTAATCGGAGCAGGTCCTGGT
GGATACGTTGCAGCAATTCGTGCAGCTCAATTAGGACAAAAAGTAACAATCGTTGAGAAA
GGTAATCTTGGTGGTGTTTGCTTAAACGTAGGATGTATTCCTTCAAAAGCATTACTACAT
GCTTCTCACCGTTTTGTTGAAGCACAACATTCTGAAAACTTAGGTGTTATTGCTGAAAGT
GTTTCTTTAAACTTCCAAAAAGTTCAAGAATTCAAATCATCAGTTGTTAATAAATTAACT
GGTGGTGTTGAAGGCTTACTTAAAGGTAACAAAGTTAACATCGTTAAAGGTGAAGCATAT
TTCGTAGATAACAATAGCTTACGTGTTATGGACGAAAAGAGCGCACAAACATACAACTTT
AAAAATGCAATCATTGCAACAGGTTCAAGACCAATTGAAATTCCTAATTTCAAATTCGGT
AAACGTGTTATCGACTCAACAGGTGCTTTAAACTTACAAGAAGTACCAGGTAAATTAGTT
GTAGTTGGTGGAGGATACATTGGATCAGAATTAGGTACAGCATTTGCTAACTTTGGTTCA
GAAGTAACCATCCTTGAAGGTGCTAAAGATATCTTAGGTGGCTTCGAAAAACAAATGACA
CAACCTGTTAAAAAAGGTATGAAAGAAAAAGGTGTTGAAATCGTTACTGAAGCTATGGCT
AAATCAGCTGAAGAAACAGATAACGGAGTTAAAGTTACTTATGAAGCTAAAGGCGAAGAG
AAAACAATCGAAGCTGATTATGTATTAGTAACTGTAGGTCGTCGTCCAAACACAGACGAA
TTAGGCCTAGAAGAATTAGGTGTTAAATTCGCTGACCGTGGATTATTAGAAGTTGATAAA
CAAAGCCGTACGTCTATCAGCAATATCTATGCAATTGGTGATATCGTTCCAGGTTTACCA
CTTGCTCACAAAGCTAGCTATGAAGCTAAAGTTGCTGCTGAAGCAATTGATGGTCAAGCT
GCTGAAGTTGATTACATTGGTATGCCAGCAGTATGCTTTACTGAACCAGAATTAGCTACA
GTTGGTTATTCAGAAGCGCAAGCTAAAGAAGAAGGTTTAGCAATTAAAGCTTCTAAATTC
CCATATGCAGCAAATGGTCGTGCATTATCATTAGATGATACTAACGGATTTGTTAAACTT
ATTACACTTAAAGAAGATGATACTTTAATCGGTGCTCAAGTAGTTGGTACTGGTGCATCA
GATATTATCTCTGAATTAGGTTTAGCAATTGAAGCTGGTATGAATGCTGAAGATATCGCA
TTAACAATCCATGCACATCCAACATTAGGTGAGATGACTATGGAAGCAGCAGAAAAAGCT
ATCGGATACCCAATCCATACAATGTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1407
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS05395 [old locus tag: NWMN_0962 ]
- symbol: NWMN_RS05395
- description: dihydrolipoyl dehydrogenase
- length: 468
- theoretical pI: 4.66989
- theoretical MW: 49451
- GRAVY: -0.00641026
⊟Function[edit | edit source]
- reaction: EC 1.8.1.4? ExPASyDihydrolipoyl dehydrogenase Protein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
- TIGRFAM: dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 565.5)and 42 moreCellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 369.4)Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 286.6)Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 257.6)mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 247.1)thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 213.5)trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 161.1)Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 115.3)Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 64.6)Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 56.6)Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 56)Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 48.8)mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 42.4)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 41.7)glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 38.3)putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 38.1)pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 37.9)putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 34.7)glutamate synthase, small subunit (TIGR01318; HMM-score: 32.3)Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 27.8)mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 21.6)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 20.5)Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19)Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 17.2)nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 16.3)lycopene cyclase family protein (TIGR01790; HMM-score: 15.9)FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 15.7)squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 15.2)Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 15)Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 14.7)Protein synthesis tRNA and rRNA base modification tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 13.4)Energy metabolism Amino acids and amines alanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 12.4)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 11.2)Energy metabolism Other 4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 11.2)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 11)Biosynthesis of cofactors, prosthetic groups, and carriers Other carotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 10.4)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 8.5)Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 8)Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 7.6)Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 6.5)Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 4.7)
- TheSEED: see NWMN_0962
- PFAM: NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 257.6)and 19 moreReductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 125.4)NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 78.5)Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 46.2)GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 36.6)HI0933_like; HI0933-like protein Rossmann domain (PF03486; HMM-score: 36.3)FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 33.2)NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 29.9)FAD_binding_2; FAD binding domain (PF00890; HMM-score: 27.7)FAD_binding_3; FAD binding domain (PF01494; HMM-score: 21.8)DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 20.6)3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 19.2)AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 17.3)NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 16.2)UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15.8)Thi4; Thi4 family (PF01946; HMM-score: 13.6)NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 11.7)XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 11.1)TrkA_N; TrkA-N domain (PF02254; HMM-score: 10.4)Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 9.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors: FAD
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.962
- Cytoplasmic Membrane Score: 0.0081
- Cell wall & surface Score: 0.0006
- Extracellular Score: 0.0294
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.021819
- TAT(Tat/SPI): 0.002475
- LIPO(Sec/SPII): 0.001894
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MVVGDFPIETDTIVIGAGPGGYVAAIRAAQLGQKVTIVEKGNLGGVCLNVGCIPSKALLHASHRFVEAQHSENLGVIAESVSLNFQKVQEFKSSVVNKLTGGVEGLLKGNKVNIVKGEAYFVDNNSLRVMDEKSAQTYNFKNAIIATGSRPIEIPNFKFGKRVIDSTGALNLQEVPGKLVVVGGGYIGSELGTAFANFGSEVTILEGAKDILGGFEKQMTQPVKKGMKEKGVEIVTEAMAKSAEETDNGVKVTYEAKGEEKTIEADYVLVTVGRRPNTDELGLEELGVKFADRGLLEVDKQSRTSISNIYAIGDIVPGLPLAHKASYEAKVAAEAIDGQAAEVDYIGMPAVCFTEPELATVGYSEAQAKEEGLAIKASKFPYAANGRALSLDDTNGFVKLITLKEDDTLIGAQVVGTGASDIISELGLAIEAGMNAEDIALTIHAHPTLGEMTMEAAEKAIGYPIHTM
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
NWMN_RS11780 (deoA) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) NWMN_RS00315 peptidoglycan-binding protein LysM [1] (data from MRSA252) NWMN_RS00885 formate acetyltransferase [1] (data from MRSA252) NWMN_RS02020 30S ribosomal protein S6 [1] (data from MRSA252) NWMN_RS02105 alkyl hydroperoxide reductase subunit C [1] (data from MRSA252) NWMN_RS02135 hypothetical protein [1] (data from MRSA252) NWMN_RS02150 IMP dehydrogenase [1] (data from MRSA252) NWMN_RS02420 ABC transporter substrate-binding protein [1] (data from MRSA252) NWMN_RS02505 YbaB/EbfC family nucleoid-associated protein [1] (data from MRSA252) NWMN_RS02655 50S ribosomal protein L25/general stress protein Ctc [1] (data from MRSA252) NWMN_RS02715 cysteine synthase [1] (data from MRSA252) NWMN_RS02815 pyridoxal 5'-phosphate synthase lyase subunit PdxS [1] (data from MRSA252) NWMN_RS02910 50S ribosomal protein L11 [1] (data from MRSA252) NWMN_RS02915 50S ribosomal protein L1 [1] (data from MRSA252) NWMN_RS02920 50S ribosomal protein L10 [1] (data from MRSA252) NWMN_RS02955 30S ribosomal protein S7 [1] (data from MRSA252) NWMN_RS02960 elongation factor G [1] (data from MRSA252) NWMN_RS02965 elongation factor Tu [1] (data from MRSA252) NWMN_RS03160 phosphate acetyltransferase [1] (data from MRSA252) NWMN_RS03300 zinc-dependent alcohol dehydrogenase [1] (data from MRSA252) NWMN_RS03425 metal ABC transporter substrate-binding protein [1] (data from MRSA252) NWMN_RS04075 ribosomal subunit interface protein [1] (data from MRSA252) NWMN_RS04195 aldehyde dehydrogenase [1] (data from MRSA252) NWMN_RS04200 phosphoglycerate kinase [1] (data from MRSA252) NWMN_RS04205 triose-phosphate isomerase [1] (data from MRSA252) NWMN_RS04210 2,3-bisphosphoglycerate-independent phosphoglycerate mutase [1] (data from MRSA252) NWMN_RS04215 enolase [1] (data from MRSA252) NWMN_RS04375 thiol reductase thioredoxin [1] (data from MRSA252) NWMN_RS04590 NADH dehydrogenase [1] (data from MRSA252) NWMN_RS04675 NAD-specific glutamate dehydrogenase [1] (data from MRSA252) NWMN_RS04700 glucose-6-phosphate isomerase [1] (data from MRSA252) NWMN_RS04730 hypothetical protein [1] (data from MRSA252) NWMN_RS04955 hypothetical protein [1] (data from MRSA252) NWMN_RS05220 bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase [1] (data from MRSA252) NWMN_RS05320 phosphocarrier protein HPr [1] (data from MRSA252) NWMN_RS05325 phosphoenolpyruvate--protein phosphotransferase [1] (data from MRSA252) NWMN_RS05380 pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) NWMN_RS05385 pyruvate dehydrogenase E1 component subunit beta [1] (data from MRSA252) NWMN_RS05390 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) NWMN_RS06210 cell division protein FtsZ [1] (data from MRSA252) NWMN_RS06475 30S ribosomal protein S16 [1] (data from MRSA252) NWMN_RS06490 50S ribosomal protein L19 [1] (data from MRSA252) NWMN_RS06515 succinyl-CoA ligase subunit beta [1] (data from MRSA252) NWMN_RS06575 30S ribosomal protein S2 [1] (data from MRSA252) NWMN_RS06585 elongation factor Ts [1] (data from MRSA252) NWMN_RS06645 translation initiation factor IF-2 [1] (data from MRSA252) NWMN_RS06840 glutamine synthetase [1] (data from MRSA252) NWMN_RS07080 transketolase [1] (data from MRSA252) NWMN_RS07390 cold-shock protein CspA [1] (data from MRSA252) NWMN_RS07455 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex [1] (data from MRSA252) NWMN_RS07460 2-oxoglutarate dehydrogenase E1 component [1] (data from MRSA252) NWMN_RS07785 DNA-binding protein HU [1] (data from MRSA252) NWMN_RS08000 phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating) [1] (data from MRSA252) NWMN_RS08350 molecular chaperone DnaK [1] (data from MRSA252) NWMN_RS08675 50S ribosomal protein L27 [1] (data from MRSA252) NWMN_RS08685 50S ribosomal protein L21 [1] (data from MRSA252) NWMN_RS08795 trigger factor [1] (data from MRSA252) NWMN_RS08820 50S ribosomal protein L20 [1] (data from MRSA252) NWMN_RS08825 50S ribosomal protein L35 [1] (data from MRSA252) NWMN_RS08840 threonine--tRNA ligase [1] (data from MRSA252) NWMN_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) NWMN_RS08930 pyruvate kinase [1] (data from MRSA252) NWMN_RS08995 universal stress protein UspA [1] (data from MRSA252) NWMN_RS09000 acetate kinase [1] (data from MRSA252) NWMN_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) NWMN_RS09125 formate--tetrahydrofolate ligase [1] (data from MRSA252) NWMN_RS09225 D-alanine aminotransferase [1] (data from MRSA252) NWMN_RS09385 transaldolase [1] (data from MRSA252) NWMN_RS10520 non-heme ferritin [1] (data from MRSA252) NWMN_RS10560 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B [1] (data from MRSA252) NWMN_RS10670 manganese-dependent inorganic pyrophosphatase [1] (data from MRSA252) NWMN_RS11180 co-chaperone GroES [1] (data from MRSA252) NWMN_RS11405 anti-sigma B factor antagonist [1] (data from MRSA252) NWMN_RS11655 uracil phosphoribosyltransferase [1] (data from MRSA252) NWMN_RS11695 50S ribosomal protein L31 type B [1] (data from MRSA252) NWMN_RS11735 DNA-directed RNA polymerase subunit delta [1] (data from MRSA252) NWMN_RS11800 DNA starvation/stationary phase protection protein [1] (data from MRSA252) NWMN_RS11875 glutamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) NWMN_RS12260 30S ribosomal protein S9 [1] (data from MRSA252) NWMN_RS12265 50S ribosomal protein L13 [1] (data from MRSA252) NWMN_RS12290 50S ribosomal protein L17 [1] (data from MRSA252) NWMN_RS12295 DNA-directed RNA polymerase subunit alpha [1] (data from MRSA252) NWMN_RS12305 30S ribosomal protein S13 [1] (data from MRSA252) NWMN_RS12330 50S ribosomal protein L15 [1] (data from MRSA252) NWMN_RS12335 50S ribosomal protein L30 [1] (data from MRSA252) NWMN_RS12340 30S ribosomal protein S5 [1] (data from MRSA252) NWMN_RS12350 50S ribosomal protein L6 [1] (data from MRSA252) NWMN_RS12355 30S ribosomal protein S8 [1] (data from MRSA252) NWMN_RS12365 50S ribosomal protein L5 [1] (data from MRSA252) NWMN_RS12380 30S ribosomal protein S17 [1] (data from MRSA252) NWMN_RS12390 50S ribosomal protein L16 [1] (data from MRSA252) NWMN_RS12395 30S ribosomal protein S3 [1] (data from MRSA252) NWMN_RS12400 50S ribosomal protein L22 [1] (data from MRSA252) NWMN_RS12405 30S ribosomal protein S19 [1] (data from MRSA252) NWMN_RS12410 50S ribosomal protein L2 [1] (data from MRSA252) NWMN_RS12415 50S ribosomal protein L23 [1] (data from MRSA252) NWMN_RS12420 50S ribosomal protein L4 [1] (data from MRSA252) NWMN_RS12425 50S ribosomal protein L3 [1] (data from MRSA252) NWMN_RS14105 L-glutamate gamma-semialdehyde dehydrogenase [1] (data from MRSA252) NWMN_RS14340 L-lactate dehydrogenase [1] (data from MRSA252) NWMN_RS14365 class I fructose-bisphosphate aldolase [1] (data from MRSA252) NWMN_RS14370 malate:quinone oxidoreductase [1] (data from MRSA252) NWMN_RS14555 ornithine carbamoyltransferase [1] (data from MRSA252) NWMN_RS14560 arginine deiminase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)