From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS10520 [old locus tag: NWMN_1831 ]
  • pan locus tag?: SAUPAN004915000
  • symbol: NWMN_RS10520
  • pan gene symbol?: ftnA
  • synonym:
  • product: non-heme ferritin

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS10520 [old locus tag: NWMN_1831 ]
  • symbol: NWMN_RS10520
  • product: non-heme ferritin
  • replicon: chromosome
  • strand: +
  • coordinates: 2037923..2038423
  • length: 501
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Location: NC_009641 (2037923..2038423) NCBI
  • BioCyc:
  • MicrobesOnline: see NWMN_1831

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGTTAAGTAAAAATTTATTAGAAGCATTAAATGATCAAATGAACCATGAGTACTTTGCA
    GCACACGCATATATGGCAATGGCAGCATACTGTGATAAAGAATCGTACGAAGGATTTGCA
    AACTTCTTCATTCAACAAGCTAAAGAAGAACGTTTCCATGGACAAAAGATTTATAACTAT
    ATTAACGACAGAGGTGCACATGCAGAATTCAGAGCAGTTTCAGCACCAAAAATTGACTTT
    TCAAGCATACTAGAAACTTTCAAAGACAGCTTATCTCAAGAACAAGAAGTAACAAGACGT
    TTCTATAACTTATCTGAAATCGCTCGTCAAGATAAAGATTATGCAACTATCTCATTCTTA
    AACTGGTTCTTAGATGAACAAGTCGAAGAAGAATCAATGTTTGAAACTCACATCAATTAT
    TTAACTCGTATCGGCGATGACAGCAATGCATTATATCTTTACGAAAAAGAACTTGGCGCT
    CGTACATTCGACGAAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    501

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS10520 [old locus tag: NWMN_1831 ]
  • symbol: NWMN_RS10520
  • description: non-heme ferritin
  • length: 166
  • theoretical pI: 4.36232
  • theoretical MW: 19588.5
  • GRAVY: -0.63253

Function[edit | edit source]

  • reaction:
    EC 1.16.3.2?  ExPASy
    Bacterial non-heme ferritin 4 Fe2+ + O2 + 6 H2O = 4 (FeO(OH)) + 8 H+
  • TIGRFAM:
    Metabolism Transport and binding proteins Cations and iron carrying compounds bacterioferritin (TIGR00754; HMM-score: 13.9)
  • TheSEED: see NWMN_1831
  • PFAM:
    Ferritin (CL0044) Ferritin; Ferritin-like domain (PF00210; HMM-score: 152.3)
    and 4 more
    Rubrerythrin; Rubrerythrin (PF02915; HMM-score: 20.6)
    P-loop_NTPase (CL0023) SLFN-g3_helicase; Schlafen group 3, DNA/RNA helicase domain (PF09848; HMM-score: 12.6)
    AB_hydrolase (CL0028) PAE; Pectinacetylesterase (PF03283; HMM-score: 12.5)
    Ferritin (CL0044) Coat_F; Coat F domain (PF07875; HMM-score: 10.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9553
    • Cytoplasmic Membrane Score: 0.0002
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0444
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.016168
    • TAT(Tat/SPI): 0.002557
    • LIPO(Sec/SPII): 0.003557
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MLSKNLLEALNDQMNHEYFAAHAYMAMAAYCDKESYEGFANFFIQQAKEERFHGQKIYNYINDRGAHAEFRAVSAPKIDFSSILETFKDSLSQEQEVTRRFYNLSEIARQDKDYATISFLNWFLDEQVEEESMFETHINYLTRIGDDSNALYLYEKELGARTFDEE

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]