Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS10520 [old locus tag: NWMN_1831 ]
- pan locus tag?: SAUPAN004915000
- symbol: NWMN_RS10520
- pan gene symbol?: ftnA
- synonym:
- product: non-heme ferritin
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS10520 [old locus tag: NWMN_1831 ]
- symbol: NWMN_RS10520
- product: non-heme ferritin
- replicon: chromosome
- strand: +
- coordinates: 2037923..2038423
- length: 501
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481ATGTTAAGTAAAAATTTATTAGAAGCATTAAATGATCAAATGAACCATGAGTACTTTGCA
GCACACGCATATATGGCAATGGCAGCATACTGTGATAAAGAATCGTACGAAGGATTTGCA
AACTTCTTCATTCAACAAGCTAAAGAAGAACGTTTCCATGGACAAAAGATTTATAACTAT
ATTAACGACAGAGGTGCACATGCAGAATTCAGAGCAGTTTCAGCACCAAAAATTGACTTT
TCAAGCATACTAGAAACTTTCAAAGACAGCTTATCTCAAGAACAAGAAGTAACAAGACGT
TTCTATAACTTATCTGAAATCGCTCGTCAAGATAAAGATTATGCAACTATCTCATTCTTA
AACTGGTTCTTAGATGAACAAGTCGAAGAAGAATCAATGTTTGAAACTCACATCAATTAT
TTAACTCGTATCGGCGATGACAGCAATGCATTATATCTTTACGAAAAAGAACTTGGCGCT
CGTACATTCGACGAAGAATAA60
120
180
240
300
360
420
480
501
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS10520 [old locus tag: NWMN_1831 ]
- symbol: NWMN_RS10520
- description: non-heme ferritin
- length: 166
- theoretical pI: 4.36232
- theoretical MW: 19588.5
- GRAVY: -0.63253
⊟Function[edit | edit source]
- reaction: EC 1.16.3.2? ExPASyBacterial non-heme ferritin 4 Fe2+ + O2 + 6 H2O = 4 (FeO(OH)) + 8 H+
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds bacterioferritin (TIGR00754; HMM-score: 13.9)
- TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
- PFAM: Ferritin (CL0044) Ferritin; Ferritin-like domain (PF00210; HMM-score: 144.2)and 5 moreRubrerythrin; Rubrerythrin (PF02915; HMM-score: 20.6)P-loop_NTPase (CL0023) DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 14.7)AB_hydrolase (CL0028) PAE; Pectinacetylesterase (PF03283; HMM-score: 13.9)Ferritin (CL0044) Ferritin_2; Ferritin-like domain (PF13668; HMM-score: 13.2)Coat_F; Coat F domain (PF07875; HMM-score: 12.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.016168
- TAT(Tat/SPI): 0.002557
- LIPO(Sec/SPII): 0.003557
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLSKNLLEALNDQMNHEYFAAHAYMAMAAYCDKESYEGFANFFIQQAKEERFHGQKIYNYINDRGAHAEFRAVSAPKIDFSSILETFKDSLSQEQEVTRRFYNLSEIARQDKDYATISFLNWFLDEQVEEESMFETHINYLTRIGDDSNALYLYEKELGARTFDEE
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
NWMN_RS11780 (deoA) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) NWMN_RS02950 30S ribosomal protein S12 [1] (data from MRSA252) NWMN_RS02960 elongation factor G [1] (data from MRSA252) NWMN_RS04590 NADH dehydrogenase [1] (data from MRSA252) NWMN_RS04915 NAD(+) kinase [1] (data from MRSA252) NWMN_RS05380 pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) NWMN_RS06475 30S ribosomal protein S16 [1] (data from MRSA252) NWMN_RS06515 succinyl-CoA ligase subunit beta [1] (data from MRSA252) NWMN_RS06840 glutamine synthetase [1] (data from MRSA252) NWMN_RS08090 elongation factor P [1] (data from MRSA252) NWMN_RS08825 50S ribosomal protein L35 [1] (data from MRSA252) NWMN_RS12390 50S ribosomal protein L16 [1] (data from MRSA252) NWMN_RS12400 50S ribosomal protein L22 [1] (data from MRSA252) NWMN_RS12410 50S ribosomal protein L2 [1] (data from MRSA252) NWMN_RS14060 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: Fur*, PerR* see NWMN_1831
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)