Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_02108
- pan locus tag?: SAUPAN004915000
- symbol: SAOUHSC_02108
- pan gene symbol?: ftnA
- synonym: JSNZ_001923
- product: ferritin
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_02108
- symbol: SAOUHSC_02108
- product: ferritin
- replicon: chromosome
- strand: +
- coordinates: 1981619..1982119
- length: 501
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3921180 NCBI
- RefSeq: YP_500600 NCBI
- BioCyc: G1I0R-1996 BioCyc
- MicrobesOnline: 1290556 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481ATGTTAAGTAAAAATTTATTAGAAGCATTAAATGATCAAATGAACCATGAGTACTTTGCA
GCACACGCATATATGGCAATGGCAGCATACTGTGATAAAGAATCGTACGAAGGATTTGCA
AACTTCTTCATTCAACAAGCTAAAGAAGAACGTTTCCATGGACAAAAGATTTATAACTAT
ATTAACGACAGAGGTGCACATGCAGAATTCAGAGCAGTTTCAGCACCAAAAATTGACTTT
TCAAGCATACTAGAAACTTTCAAAGACAGCTTATCTCAAGAACAAGAAGTAACAAGACGT
TTCTATAACTTATCTGAAATCGCTCGTCAAGATAAAGATTATGCAACTATCTCATTCTTA
AACTGGTTCTTAGATGAACAAGTCGAAGAAGAATCAATGTTTGAAACTCACATCAATTAT
TTAACTCGTATCGGCGATGACAGCAATGCATTATATCTTTACGAAAAAGAACTTGGCGCT
CGTACATTCGACGAAGAATAA60
120
180
240
300
360
420
480
501
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_02108
- symbol: SAOUHSC_02108
- description: ferritin
- length: 166
- theoretical pI: 4.36232
- theoretical MW: 19588.5
- GRAVY: -0.63253
⊟Function[edit | edit source]
- reaction: EC 1.16.3.2? ExPASyBacterial non-heme ferritin 4 Fe2+ + O2 + 6 H2O = 4 (FeO(OH)) + 8 H+
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds bacterioferritin (TIGR00754; HMM-score: 13.9)
- TheSEED :
- Bacterial non-heme ferritin (EC 1.16.3.2)
- PFAM: Ferritin (CL0044) Ferritin; Ferritin-like domain (PF00210; HMM-score: 152.3)and 4 moreRubrerythrin; Rubrerythrin (PF02915; HMM-score: 20.6)P-loop_NTPase (CL0023) SLFN-g3_helicase; Schlafen group 3, DNA/RNA helicase domain (PF09848; HMM-score: 12.6)AB_hydrolase (CL0028) PAE; Pectinacetylesterase (PF03283; HMM-score: 12.5)Ferritin (CL0044) Coat_F; Coat F domain (PF07875; HMM-score: 10.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9553
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0444
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.016168
- TAT(Tat/SPI): 0.002557
- LIPO(Sec/SPII): 0.003557
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLSKNLLEALNDQMNHEYFAAHAYMAMAAYCDKESYEGFANFFIQQAKEERFHGQKIYNYINDRGAHAEFRAVSAPKIDFSSILETFKDSLSQEQEVTRRFYNLSEIARQDKDYATISFLNWFLDEQVEEESMFETHINYLTRIGDDSNALYLYEKELGARTFDEE
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAOUHSC_00943 (ppnK) inorganic polyphosphate/ATP-NAD kinase [3] (data from MRSA252) SAOUHSC_02509 (rplB) 50S ribosomal protein L2 [3] (data from MRSA252) SAOUHSC_02505 (rplP) 50S ribosomal protein L16 [3] (data from MRSA252) SAOUHSC_02507 (rplV) 50S ribosomal protein L22 [3] (data from MRSA252) SAOUHSC_01785 (rpmI) 50S ribosomal protein L35 [3] (data from MRSA252) SAOUHSC_00527 (rpsL) 30S ribosomal protein S12 [3] (data from MRSA252) SAOUHSC_01208 (rpsP) 30S ribosomal protein S16 [3] (data from MRSA252) SAOUHSC_01216 (sucC) succinyl-CoA synthetase subunit beta [3] (data from MRSA252) SAOUHSC_00529 elongation factor G [3] (data from MRSA252) SAOUHSC_00878 hypothetical protein [3] (data from MRSA252) SAOUHSC_01040 pyruvate dehydrogenase complex, E1 component subunit alpha [3] (data from MRSA252) SAOUHSC_01287 glutamine synthetase [3] (data from MRSA252) SAOUHSC_01625 elongation factor P [3] (data from MRSA252) SAOUHSC_02377 pyrimidine-nucleoside phosphorylase [3] (data from MRSA252) SAOUHSC_02860 HMG-CoA synthase [3] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- predicted SigA promoter [4] : SAOUHSC_02108 > S828 > S829 > SAOUHSC_02110
⊟Regulation[edit | edit source]
- regulators: Fur*/JSNZ_001486 (repression) regulon, PerR*/JSNZ_001889 (repression) regulon
Fur*/JSNZ_001486 (TF) important in Iron homeostasis; RegPrecise PerR*/JSNZ_001889 (TF) important in Oxidative stress response; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [4]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ 4.0 4.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
⊟Relevant publications[edit | edit source]
M J Horsburgh, M O Clements, H Crossley, E Ingham, S J Foster
PerR controls oxidative stress resistance and iron storage proteins and is required for virulence in Staphylococcus aureus.
Infect Immun: 2001, 69(6);3744-54
[PubMed:11349039] [WorldCat.org] [DOI] (P p)Julie A Morrissey, Alan Cockayne, Kirsty Brummell, Paul Williams
The staphylococcal ferritins are differentially regulated in response to iron and manganese and via PerR and Fur.
Infect Immun: 2004, 72(2);972-9
[PubMed:14742543] [WorldCat.org] [DOI] (P p)
