From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1952 [new locus tag: SACOL_RS10210 ]
  • pan locus tag?: SAUPAN004915000
  • symbol: SACOL1952
  • pan gene symbol?: ftnA
  • synonym:
  • product: ferritins family protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1952 [new locus tag: SACOL_RS10210 ]
  • symbol: SACOL1952
  • product: ferritins family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2013598..2014098
  • length: 501
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGTTAAGTAAAAATTTATTAGAAGCATTAAATGATCAAATGAACCATGAGTACTTTGCA
    GCACACGCATATATGGCAATGGCAGCATACTGTGATAAAGAATCGTACGAAGGATTTGCA
    AACTTCTTCATTCAACAAGCTAAAGAAGAACGTTTCCATGGACAAAAGATTTATAACTAT
    ATTAACGACAGAGGTGCACATGCAGAATTCAGAGCAGTTTCAGCACCAAAAATTGACTTT
    TCAAGCATACTAGAAACTTTCAAAGACAGCTTATCTCAAGAACAAGAAGTAACAAGACGT
    TTCTATAACTTATCTGAAATCGCTCGTCAAGATAAAGATTATGCAACTATCTCATTCTTA
    AACTGGTTCTTAGATGAACAAGTCGAAGAAGAATCAATGTTTGAAACTCACATCAATTAT
    TTAACTCGTATCGGCGATGACAGCAATGCATTATATCTTTACGAAAAAGAACTTGGCGCT
    CGTACATTCGACGAAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    501


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1952 [new locus tag: SACOL_RS10210 ]
  • symbol: SACOL1952
  • description: ferritins family protein
  • length: 166
  • theoretical pI: 4.36232
  • theoretical MW: 19588.5
  • GRAVY: -0.63253

Function[edit | edit source]

  • reaction:
    EC 1.16.3.2?  ExPASy
    Bacterial non-heme ferritin 4 Fe2+ + O2 + 6 H2O = 4 (FeO(OH)) + 8 H+
  • TIGRFAM:
    Metabolism Transport and binding proteins Cations and iron carrying compounds bacterioferritin (TIGR00754; HMM-score: 13.9)
  • TheSEED  :
    • Bacterial non-heme ferritin (EC 1.16.3.2)
  • PFAM:
    Ferritin (CL0044) Ferritin; Ferritin-like domain (PF00210; HMM-score: 152.3)
    and 4 more
    Rubrerythrin; Rubrerythrin (PF02915; HMM-score: 20.6)
    P-loop_NTPase (CL0023) SLFN-g3_helicase; Schlafen group 3, DNA/RNA helicase domain (PF09848; HMM-score: 12.6)
    AB_hydrolase (CL0028) PAE; Pectinacetylesterase (PF03283; HMM-score: 12.5)
    Ferritin (CL0044) Coat_F; Coat F domain (PF07875; HMM-score: 10.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9553
    • Cytoplasmic Membrane Score: 0.0002
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0444
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.016168
    • TAT(Tat/SPI): 0.002557
    • LIPO(Sec/SPII): 0.003557
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MLSKNLLEALNDQMNHEYFAAHAYMAMAAYCDKESYEGFANFFIQQAKEERFHGQKIYNYINDRGAHAEFRAVSAPKIDFSSILETFKDSLSQEQEVTRRFYNLSEIARQDKDYATISFLNWFLDEQVEEESMFETHINYLTRIGDDSNALYLYEKELGARTFDEE

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3] [4]
  • quantitative data / protein copy number per cell: 4954 [5]
  • interaction partners:
    SACOL1587(efp)elongation factor P  [6] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [6] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [6] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [6] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [6] (data from MRSA252)
    SACOL1011(ppnK)inorganic polyphosphate/ATP-NAD kinase  [6] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [6] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [6] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [6] (data from MRSA252)
    SACOL1726(rpmI)50S ribosomal protein L35  [6] (data from MRSA252)
    SACOL0591(rpsL)30S ribosomal protein S12  [6] (data from MRSA252)
    SACOL1254(rpsP)30S ribosomal protein S16  [6] (data from MRSA252)
    SACOL1262(sucC)succinyl-CoA synthetase subunit beta  [6] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [6] (data from MRSA252)
    SACOL2561hydroxymethylglutaryl-CoA synthase  [6] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulators: Fur* (repression) regulon, PerR* (repression) regulon
    Fur*(TF)important in Iron homeostasis; RegPrecise 
    PerR*(TF)important in Oxidative stress response; RegPrecise 

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 26.73 h [7]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  7. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]