From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2325 [new locus tag: SACOL_RS12225 ]
  • pan locus tag?: SAUPAN005819000
  • symbol: SACOL2325
  • pan gene symbol?: hutR
  • synonym:
  • product: LysR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2325 [new locus tag: SACOL_RS12225 ]
  • symbol: SACOL2325
  • product: LysR family transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 2387560..2388444
  • length: 885
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAAAATTATTCAGTTAGAATACTTCTTGGCTATCGTGAAATATAATAGTTTTACTAAA
    GCTGCACAATTTTTACATATTAGCCAGCCATCTTTAACTGCTACGATTAAAAAAATGGAA
    GCAGATTTAGGTTATGACTTATTTACACGTTCAACAAAAGACATCAAGATTACCGAAAAA
    GGAATACAGTTTTATCGTTATGCGAGCGAATTAGTTCAACAATATCGATCCACGATGGAA
    AAAATGTATGATTTAAGCGTTACATCAGAACCAAGGATAAAAATTGGGACTCTTGAATCT
    ACGAATCAATGGATTGCGAATTTAATTCGAAAGCACCATTCCGACTACCCTGAACAGCAA
    TATCGTTTATATGAAATACATGATAAACATCAATCTATAGAGCAATTACTGAATTTTAAT
    ATTCATTTAGCTATAACAAATGAAAAAATAACCCACGAAGATATAAGATCCATTCCTTTA
    TATGAGGAATCTTACATTTTATTAGCACCCAAGGAAACATTTAAAAATCAAAATTGGGTA
    GATGTTGAAAATTTGCCACTCATATTACCAAACAAAAATTCTCAAGTGCGCAAACACTTA
    GATGACTATTTTAATAGAAGAAATATTCGTCCAAATGTCGTTGTAGAAACAGATCGATTC
    GAATCAGCAGTTGGATTTGTTCATCTCGGCTTAGGTTACGCTATCATTCCGAGATTTTAT
    TACCAATCATTTCACACGTCTAATTTAGAATATAAAAAAATTCGTCCAAACTTAGGCCGA
    AAAATTTATATCAATTACCATAAAAAACGCAAACACTCCGAACAAGTACATACATTCGTA
    CAACAATGCCAAGATTATTTATATGGACTTTTAGAGGCTCTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2325 [new locus tag: SACOL_RS12225 ]
  • symbol: SACOL2325
  • description: LysR family transcriptional regulator
  • length: 294
  • theoretical pI: 9.38669
  • theoretical MW: 35017.8
  • GRAVY: -0.546939

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions aminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 94.6)
    Metabolism Energy metabolism Other pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)
    Signal transduction Regulatory functions DNA interactions pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)
    and 6 more
    Cellular processes Cellular processes Toxin production and resistance transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)
    Signal transduction Regulatory functions DNA interactions transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)
    putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 43.9)
    Signal transduction Regulatory functions DNA interactions D-serine deaminase transcriptional activator (TIGR02036; HMM-score: 26.9)
    homoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 13.4)
  • TheSEED  :
    • Transcriptional regulator, LysR family
  • PFAM:
    PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 112.9)
    and 3 more
    HTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 64.3)
    NUMOD1; NUMOD1 domain (PF07453; HMM-score: 15.3)
    no clan defined LOH1CR12; Tumour suppressor protein (PF10158; HMM-score: 8.9)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.039007
    • TAT(Tat/SPI): 0.004353
    • LIPO(Sec/SPII): 0.002704
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKIIQLEYFLAIVKYNSFTKAAQFLHISQPSLTATIKKMEADLGYDLFTRSTKDIKITEKGIQFYRYASELVQQYRSTMEKMYDLSVTSEPRIKIGTLESTNQWIANLIRKHHSDYPEQQYRLYEIHDKHQSIEQLLNFNIHLAITNEKITHEDIRSIPLYEESYILLAPKETFKNQNWVDVENLPLILPNKNSQVRKHLDDYFNRRNIRPNVVVETDRFESAVGFVHLGLGYAIIPRFYYQSFHTSNLEYKKIRPNLGRKIYINYHKKRKHSEQVHTFVQQCQDYLYGLLEAL

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2]
  • quantitative data / protein copy number per cell:
  • interaction partners:
    SACOL1760(ackA)acetate kinase  [3] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [3] (data from MRSA252)
    SACOL1215(carB)carbamoyl phosphate synthase large subunit  [3] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [3] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [3] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [3] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [3] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [3] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [3] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [3] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [3] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [3] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [3] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [3] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [3] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [3] (data from MRSA252)
    SACOL1477(ilvA1)threonine dehydratase  [3] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [3] (data from MRSA252)
    SACOL2092(murAA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [3] (data from MRSA252)
    SACOL0792(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [3] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [3] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [3] (data from MRSA252)
    SACOL0544(prsA)ribose-phosphate pyrophosphokinase  [3] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [3] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [3] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [3] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [3] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [3] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [3] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [3] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [3] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [3] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [3] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [3] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [3] (data from MRSA252)
    SACOL2225(rpsH)30S ribosomal protein S8  [3] (data from MRSA252)
    SACOL0816(secA)preprotein translocase subunit SecA  [3] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [3] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [3] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [3] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [3] (data from MRSA252)
    SACOL0426acetyl-CoA acetyltransferase  [3] (data from MRSA252)
    SACOL0599hypothetical protein  [3] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [3] (data from MRSA252)
    SACOL0742hypothetical protein  [3] (data from MRSA252)
    SACOL1759universal stress protein  [3] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [3] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: HutR* (activation) regulon
    HutR*(TF)important in Histidine utilization; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.20 3.21 3.22 3.23 3.24 3.25 3.26 3.27 3.28 3.29 3.30 3.31 3.32 3.33 3.34 3.35 3.36 3.37 3.38 3.39 3.40 3.41 3.42 3.43 3.44 3.45 3.46 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]