Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2325 [new locus tag: SACOL_RS12225 ]
- pan locus tag?: SAUPAN005819000
- symbol: SACOL2325
- pan gene symbol?: hutR
- synonym:
- product: LysR family transcriptional regulator
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2325 [new locus tag: SACOL_RS12225 ]
- symbol: SACOL2325
- product: LysR family transcriptional regulator
- replicon: chromosome
- strand: +
- coordinates: 2387560..2388444
- length: 885
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238483 NCBI
- RefSeq: YP_187132 NCBI
- BioCyc: see SACOL_RS12225
- MicrobesOnline: 913807 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGAAAATTATTCAGTTAGAATACTTCTTGGCTATCGTGAAATATAATAGTTTTACTAAA
GCTGCACAATTTTTACATATTAGCCAGCCATCTTTAACTGCTACGATTAAAAAAATGGAA
GCAGATTTAGGTTATGACTTATTTACACGTTCAACAAAAGACATCAAGATTACCGAAAAA
GGAATACAGTTTTATCGTTATGCGAGCGAATTAGTTCAACAATATCGATCCACGATGGAA
AAAATGTATGATTTAAGCGTTACATCAGAACCAAGGATAAAAATTGGGACTCTTGAATCT
ACGAATCAATGGATTGCGAATTTAATTCGAAAGCACCATTCCGACTACCCTGAACAGCAA
TATCGTTTATATGAAATACATGATAAACATCAATCTATAGAGCAATTACTGAATTTTAAT
ATTCATTTAGCTATAACAAATGAAAAAATAACCCACGAAGATATAAGATCCATTCCTTTA
TATGAGGAATCTTACATTTTATTAGCACCCAAGGAAACATTTAAAAATCAAAATTGGGTA
GATGTTGAAAATTTGCCACTCATATTACCAAACAAAAATTCTCAAGTGCGCAAACACTTA
GATGACTATTTTAATAGAAGAAATATTCGTCCAAATGTCGTTGTAGAAACAGATCGATTC
GAATCAGCAGTTGGATTTGTTCATCTCGGCTTAGGTTACGCTATCATTCCGAGATTTTAT
TACCAATCATTTCACACGTCTAATTTAGAATATAAAAAAATTCGTCCAAACTTAGGCCGA
AAAATTTATATCAATTACCATAAAAAACGCAAACACTCCGAACAAGTACATACATTCGTA
CAACAATGCCAAGATTATTTATATGGACTTTTAGAGGCTCTTTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
885
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2325 [new locus tag: SACOL_RS12225 ]
- symbol: SACOL2325
- description: LysR family transcriptional regulator
- length: 294
- theoretical pI: 9.38669
- theoretical MW: 35017.8
- GRAVY: -0.546939
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions aminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 94.6)Energy metabolism Other pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)Regulatory functions DNA interactions pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)and 6 moreCellular processes Toxin production and resistance transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)DNA metabolism DNA replication, recombination, and repair transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)Regulatory functions DNA interactions transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 43.9)Regulatory functions DNA interactions D-serine deaminase transcriptional activator (TIGR02036; HMM-score: 26.9)homoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 13.4)
- TheSEED :
- Transcriptional regulator, LysR family
- PFAM: PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 123.7)and 4 moreHTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 67.2)NUMOD1; NUMOD1 domain (PF07453; HMM-score: 15.1)MmeI_HD-like (CL0884) HsdM_N; HsdM N-terminal domain (PF12161; HMM-score: 15.1)CheY (CL0304) TadZ-like_ARD; TadZ-like, receiver domain (PF21194; HMM-score: 13.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effector: Histidine
- genes regulated by HutR*, TF important in Histidine utilizationRegPrecisetranscription units transferred from N315 data RegPrecise
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9196
- Cytoplasmic Membrane Score: 0.0688
- Cell wall & surface Score: 0.0008
- Extracellular Score: 0.0108
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.039007
- TAT(Tat/SPI): 0.004353
- LIPO(Sec/SPII): 0.002704
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKIIQLEYFLAIVKYNSFTKAAQFLHISQPSLTATIKKMEADLGYDLFTRSTKDIKITEKGIQFYRYASELVQQYRSTMEKMYDLSVTSEPRIKIGTLESTNQWIANLIRKHHSDYPEQQYRLYEIHDKHQSIEQLLNFNIHLAITNEKITHEDIRSIPLYEESYILLAPKETFKNQNWVDVENLPLILPNKNSQVRKHLDDYFNRRNIRPNVVVETDRFESAVGFVHLGLGYAIIPRFYYQSFHTSNLEYKKIRPNLGRKIYINYHKKRKHSEQVHTFVQQCQDYLYGLLEAL
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2]
- quantitative data / protein copy number per cell:
- interaction partners:
SACOL1760 (ackA) acetate kinase [3] (data from MRSA252) SACOL2657 (arcA) arginine deiminase [3] (data from MRSA252) SACOL1215 (carB) carbamoyl phosphate synthase large subunit [3] (data from MRSA252) SACOL1637 (dnaK) molecular chaperone DnaK [3] (data from MRSA252) SACOL0842 (eno) phosphopyruvate hydratase [3] (data from MRSA252) SACOL1016 (fabI) enoyl-ACP reductase [3] (data from MRSA252) SACOL2622 (fdaB) fructose-1,6-bisphosphate aldolase [3] (data from MRSA252) SACOL1199 (ftsZ) cell division protein FtsZ [3] (data from MRSA252) SACOL0593 (fusA) elongation factor G [3] (data from MRSA252) SACOL0838 (gapA1) glyceraldehyde 3-phosphate dehydrogenase [3] (data from MRSA252) SACOL1961 (gatA) aspartyl/glutamyl-tRNA amidotransferase subunit A [3] (data from MRSA252) SACOL2145 (glmS) glucosamine--fructose-6-phosphate aminotransferase [3] (data from MRSA252) SACOL1554 (gnd) 6-phosphogluconate dehydrogenase [3] (data from MRSA252) SACOL2016 (groEL) chaperonin GroEL [3] (data from MRSA252) SACOL1513 (hup) DNA-binding protein HU [3] (data from MRSA252) SACOL1741 (icd) isocitrate dehydrogenase [3] (data from MRSA252) SACOL1477 (ilvA1) threonine dehydratase [3] (data from MRSA252) SACOL0222 (ldh1) L-lactate dehydrogenase [3] (data from MRSA252) SACOL2092 (murAA) UDP-N-acetylglucosamine 1-carboxyvinyltransferase [3] (data from MRSA252) SACOL0792 (nrdE) ribonucleotide-diphosphate reductase subunit alpha [3] (data from MRSA252) SACOL1102 (pdhA) pyruvate dehydrogenase complex E1 component subunit alpha [3] (data from MRSA252) SACOL0204 (pflB) formate acetyltransferase [3] (data from MRSA252) SACOL0544 (prsA) ribose-phosphate pyrophosphokinase [3] (data from MRSA252) SACOL1745 (pyk) pyruvate kinase [3] (data from MRSA252) SACOL0584 (rplA) 50S ribosomal protein L1 [3] (data from MRSA252) SACOL2227 (rplE) 50S ribosomal protein L5 [3] (data from MRSA252) SACOL0583 (rplK) 50S ribosomal protein L11 [3] (data from MRSA252) SACOL0586 (rplL) 50S ribosomal protein L7/L12 [3] (data from MRSA252) SACOL2232 (rplP) 50S ribosomal protein L16 [3] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [3] (data from MRSA252) SACOL1702 (rplU) 50S ribosomal protein L21 [3] (data from MRSA252) SACOL2237 (rplW) 50S ribosomal protein L23 [3] (data from MRSA252) SACOL1274 (rpsB) 30S ribosomal protein S2 [3] (data from MRSA252) SACOL2222 (rpsE) 30S ribosomal protein S5 [3] (data from MRSA252) SACOL0592 (rpsG) 30S ribosomal protein S7 [3] (data from MRSA252) SACOL2225 (rpsH) 30S ribosomal protein S8 [3] (data from MRSA252) SACOL0816 (secA) preprotein translocase subunit SecA [3] (data from MRSA252) SACOL1448 (sucB) dihydrolipoamide succinyltransferase [3] (data from MRSA252) SACOL1276 (tsf) elongation factor Ts [3] (data from MRSA252) SACOL0594 (tuf) elongation factor Tu [3] (data from MRSA252) SACOL2104 (upp) uracil phosphoribosyltransferase [3] (data from MRSA252) SACOL0426 acetyl-CoA acetyltransferase [3] (data from MRSA252) SACOL0599 hypothetical protein [3] (data from MRSA252) SACOL0731 LysR family transcriptional regulator [3] (data from MRSA252) SACOL0742 hypothetical protein [3] (data from MRSA252) SACOL1759 universal stress protein [3] (data from MRSA252) SACOL2173 alkaline shock protein 23 [3] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: HutR* (activation) regulon
HutR* (TF) important in Histidine utilization; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.20 3.21 3.22 3.23 3.24 3.25 3.26 3.27 3.28 3.29 3.30 3.31 3.32 3.33 3.34 3.35 3.36 3.37 3.38 3.39 3.40 3.41 3.42 3.43 3.44 3.45 3.46 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)