Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_002300
- pan locus tag?: SAUPAN005819000
- symbol: JSNZ_002300
- pan gene symbol?: hutR
- synonym:
- product: LysR family transcriptional regulator
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_002300
- symbol: JSNZ_002300
- product: LysR family transcriptional regulator
- replicon: chromosome
- strand: +
- coordinates: 2297941..2298825
- length: 885
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGAAAATTATTCAGTTAGAATACTTCTTGGCTATCGTGAAATATAATAGTTTTACTAAA
GCTGCACAATTTTTACATATTAGCCAGCCATCTTTAACTGCTACGATTAAAAAAATGGAA
GCAGATTTAGGTTATGACTTATTTACACGTTCAACAAAAGACATCAAGATTACCGAAAAA
GGAATACAGTTTTATCGTTATGCGAGCGAATTAGTTCAACAATATCGATCCACGATGGAA
AAAATGTATGATTTAAGCGTTACATCAGAACCAAGGATAAAAATTGGGACTCTTGAATCT
ACGAATCAATGGATTGCGAATTTAATTCGAAAGCACCATTCCGACTACCCTGAACAGCAA
TATCGTTTATATGAAATACATGACAAACATCAATCTATAGAGCAATTACTGAATTTTAAT
ATTCATTTAGCTATAACAAATGAAAAAATAACCCACGAAGATATAAGATCTATTCCTTTA
TATGAGGAATCTTACATTTTATTAGCACCCAAGGAAACATTTAAAAATCAAAATTGGGTA
GATGTTGAAAATTTGCCACTCATATTACCAAACAAAAATTCTCAAGTGCGCAAACACTTA
GATGACTATTTTAATAGAAGAAATATTCGTCCAAATGTCGTTGTAGAAACAGATCGATTC
GAATCAGCAGTTGGATTTGTTCATCTCGGCTTAGGTTACGCTATCATTCCGAGATTTTAT
TACCAATCATTTCACACGTCTAATTTAGAATATAAAAAAATTCGTCCAAACTTAGGCCGA
AAAATTTATATCAATTACCATAAAAAACGCAAACACTCCGAACAAGTACATACATTCGTA
CAACAATGCCAAGATTATTTATATGGACTTTTAGAGGCTCTTTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
885
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_002300
- symbol: JSNZ_002300
- description: LysR family transcriptional regulator
- length: 294
- theoretical pI: 9.38669
- theoretical MW: 35017.8
- GRAVY: -0.546939
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions aminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 94.6)Energy metabolism Other pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)Regulatory functions DNA interactions pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)and 6 moreCellular processes Toxin production and resistance transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)DNA metabolism DNA replication, recombination, and repair transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)Regulatory functions DNA interactions transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 43.9)Regulatory functions DNA interactions D-serine deaminase transcriptional activator (TIGR02036; HMM-score: 26.9)homoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 13.4)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 123.7)and 4 moreHTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 67.2)NUMOD1; NUMOD1 domain (PF07453; HMM-score: 15.1)MmeI_HD-like (CL0884) HsdM_N; HsdM N-terminal domain (PF12161; HMM-score: 15.1)CheY (CL0304) TadZ-like_ARD; TadZ-like, receiver domain (PF21194; HMM-score: 13.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effector: Histidine
- genes regulated by HutR*, TF important in Histidine utilization
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9196
- Cytoplasmic Membrane Score: 0.0688
- Cell wall & surface Score: 0.0008
- Extracellular Score: 0.0108
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.039007
- TAT(Tat/SPI): 0.004353
- LIPO(Sec/SPII): 0.002704
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MKIIQLEYFLAIVKYNSFTKAAQFLHISQPSLTATIKKMEADLGYDLFTRSTKDIKITEKGIQFYRYASELVQQYRSTMEKMYDLSVTSEPRIKIGTLESTNQWIANLIRKHHSDYPEQQYRLYEIHDKHQSIEQLLNFNIHLAITNEKITHEDIRSIPLYEESYILLAPKETFKNQNWVDVENLPLILPNKNSQVRKHLDDYFNRRNIRPNVVVETDRFESAVGFVHLGLGYAIIPRFYYQSFHTSNLEYKKIRPNLGRKIYINYHKKRKHSEQVHTFVQQCQDYLYGLLEAL
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulators: HutR* (activation) regulon, CcpA regulon
HutR* (TF) important in Histidine utilization; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026) CcpA (TF) important in Carbon catabolism; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026)
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]