Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1414 [new locus tag: SA_RS07985 ]
- pan locus tag?: SAUPAN004172000
- symbol: rpsT
- pan gene symbol?: rpsT
- synonym:
- product: 30S ribosomal protein S20
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1414 [new locus tag: SA_RS07985 ]
- symbol: rpsT
- product: 30S ribosomal protein S20
- replicon: chromosome
- strand: +
- coordinates: 1621010..1621261
- length: 252
- essential: yes DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124256 NCBI
- RefSeq: NP_374699 NCBI
- BioCyc: see SA_RS07985
- MicrobesOnline: 103725 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGGCAAATATCAAATCTGCAATTAAACGTGTAAAAACAACTGAAAAAGCTGAAGCACGC
AACATTTCACAAAAGAGTGCAATGCGTACAGCAGTTAAAAACGCTAAAACAGCTGTTTCA
AATAACGCTGATAATAAAAATGAATTAGTAAGCTTAGCAGTTAAGTTAGTAGACAAAGCT
GCTCAAAGTAATTTAATACATTCAAACAAAGCTGACCGTATTAAATCACAATTAATGACT
GCAAATAAATAA60
120
180
240
252
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1414 [new locus tag: SA_RS07985 ]
- symbol: RpsT
- description: 30S ribosomal protein S20
- length: 83
- theoretical pI: 11.2814
- theoretical MW: 9021.38
- GRAVY: -0.610843
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS20 (TIGR00029; HMM-score: 68)and 1 moreEnergy metabolism Amino acids and amines tryptophan 2,3-dioxygenase (TIGR03036; EC 1.13.11.11; HMM-score: 14.1)
- TheSEED :
- SSU ribosomal protein S20p
- PFAM: no clan defined Ribosomal_S20p; Ribosomal protein S20 (PF01649; HMM-score: 79.3)and 2 moreUbiquitin (CL0072) UN_NPL4; Nuclear pore localisation protein NPL4 (PF11543; HMM-score: 14)BRCT-like (CL0459) RTT107_BRCT_5; Regulator of Ty1 transposition protein 107 BRCT domain (PF16770; HMM-score: 12.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0.4398
- Cytoplasmic Membrane Score: 0
- Cell wall & surface Score: 0.0101
- Extracellular Score: 0.5501
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.015523
- TAT(Tat/SPI): 0.001531
- LIPO(Sec/SPII): 0.001817
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MANIKSAIKRVKTTEKAEARNISQKSAMRTAVKNAKTAVSNNADNKNELVSLAVKLVDKAAQSNLIHSNKADRIKSQLMTANK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA1517 (citC) isocitrate dehydrogenase [1] (data from MRSA252) SA1409 (dnaK) molecular chaperone DnaK [1] (data from MRSA252) SA0731 (eno) phosphopyruvate hydratase [1] (data from MRSA252) SA1553 (fhs) formate--tetrahydrofolate ligase [1] (data from MRSA252) SA0505 (fus) elongation factor G [1] (data from MRSA252) SA0727 (gap) glyceraldehyde-3-phosphate dehydrogenase [1] (data from MRSA252) SA1305 (hu) DNA-binding protein II [1] (data from MRSA252) SA1112 (infB) translation initiation factor IF-2 [1] (data from MRSA252) SA1504 (infC) translation initiation factor IF-3 [1] (data from MRSA252) SA1244 (odhB) dihydrolipoamide succinyltransferase [1] (data from MRSA252) SA0945 (pdhC) branched-chain alpha-keto acid dehydrogenase E2 subunit [1] (data from MRSA252) SA0946 (pdhD) dihydrolipoamide dehydrogenase [1] (data from MRSA252) SA0218 (pflB) formate acetyltransferase [1] (data from MRSA252) SA0496 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SA2044 (rplB) 50S ribosomal protein L2 [1] (data from MRSA252) SA2047 (rplC) 50S ribosomal protein L3 [1] (data from MRSA252) SA2046 (rplD) 50S ribosomal protein L4 [1] (data from MRSA252) SA2035 (rplE) 50S ribosomal protein L5 [1] (data from MRSA252) SA2033 (rplF) 50S ribosomal protein L6 [1] (data from MRSA252) SA0497 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SA0495 (rplK) 50S ribosomal protein L11 [1] (data from MRSA252) SA0498 (rplL) 50S ribosomal protein L7/L12 [1] (data from MRSA252) SA2029 (rplO) 50S ribosomal protein L15 [1] (data from MRSA252) SA2040 (rplP) 50S ribosomal protein L16 [1] (data from MRSA252) SA2022 (rplQ) 50S ribosomal protein L17 [1] (data from MRSA252) SA1084 (rplS) 50S ribosomal protein L19 [1] (data from MRSA252) SA1473 (rplU) 50S ribosomal protein L21 [1] (data from MRSA252) SA2042 (rplV) 50S ribosomal protein L22 [1] (data from MRSA252) SA2045 (rplW) 50S ribosomal protein L23 [1] (data from MRSA252) SA1471 (rpmA) 50S ribosomal protein L27 [1] (data from MRSA252) SA1922 (rpmE2) 50S ribosomal protein L31 [1] (data from MRSA252) SA1099 (rpsB) 30S ribosomal protein S2 [1] (data from MRSA252) SA2041 (rpsC) 30S ribosomal protein S3 [1] (data from MRSA252) SAS052 (rpsD) 30S ribosomal protein S4 [1] (data from MRSA252) SA2031 (rpsE) 30S ribosomal protein S5 [1] (data from MRSA252) SA2016 (rpsI) 30S ribosomal protein S9 [1] (data from MRSA252) SA2024 (rpsK) 30S ribosomal protein S11 [1] (data from MRSA252) SA2038 (rpsQ) 30S ribosomal protein S17 [1] (data from MRSA252) SA2043 (rpsS) 30S ribosomal protein S19 [1] (data from MRSA252) SA0107 (spa) immunoglobulin G binding protein A [1] (data from MRSA252) SA1499 (tig) trigger factor [1] (data from MRSA252) SA1100 (tsf) elongation factor Ts [1] (data from MRSA252) SA0506 (tuf) elongation factor Tu [1] (data from MRSA252) SA0295 hypothetical protein [1] (data from MRSA252) SA0627 hypothetical protein [1] (data from MRSA252) SA0802 hypothetical protein [1] (data from MRSA252) SA0940 hypothetical protein [1] (data from MRSA252) SA1528 hypothetical protein [1] (data from MRSA252) SA1709 hypothetical protein [1] (data from MRSA252) SA1885 hypothetical protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)