From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1642 [new locus tag: SACOL_RS08375 ]
  • pan locus tag?: SAUPAN004172000
  • symbol: rpsT
  • pan gene symbol?: rpsT
  • synonym:
  • product: 30S ribosomal protein S20

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1642 [new locus tag: SACOL_RS08375 ]
  • symbol: rpsT
  • product: 30S ribosomal protein S20
  • replicon: chromosome
  • strand: +
  • coordinates: 1674066..1674317
  • length: 252
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    ATGGCAAATATCAAATCTGCAATTAAACGTGTAAAAACAACTGAAAAAGCTGAAGCACGC
    AACATTTCACAAAAGAGTGCAATGCGTACAGCAGTTAAAAACGCTAAAACAGCTGTTTCA
    AATAACGCTGATAATAAAAATGAATTAGTAAGCTTAGCAGTTAAGTTAGTAGACAAAGCT
    GCTCAAAGTAATTTAATACATTCAAACAAAGCTGACCGTATTAAATCACAATTAATGACT
    GCAAATAAATAA
    60
    120
    180
    240
    252


⊟Protein[edit | edit source]

Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5TCU

⊟General[edit | edit source]

  • locus tag: SACOL1642 [new locus tag: SACOL_RS08375 ]
  • symbol: RpsT
  • description: 30S ribosomal protein S20
  • length: 83
  • theoretical pI: 11.2814
  • theoretical MW: 9021.38
  • GRAVY: -0.610843

⊟Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS20 (TIGR00029; HMM-score: 68)
    and 1 more
    Metabolism Energy metabolism Amino acids and amines tryptophan 2,3-dioxygenase (TIGR03036; EC 1.13.11.11; HMM-score: 14.1)
  • TheSEED  :
    • SSU ribosomal protein S20p
    Protein Metabolism Protein biosynthesis Ribosome SSU bacterial  SSU ribosomal protein S20p
  • PFAM:
    no clan defined Ribosomal_S20p; Ribosomal protein S20 (PF01649; HMM-score: 79.3)
    and 2 more
    Ubiquitin (CL0072) UN_NPL4; Nuclear pore localisation protein NPL4 (PF11543; HMM-score: 14)
    BRCT-like (CL0459) RTT107_BRCT_5; Regulator of Ty1 transposition protein 107 BRCT domain (PF16770; HMM-score: 12.9)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0.4398
    • Cytoplasmic Membrane Score: 0
    • Cell wall & surface Score: 0.0101
    • Extracellular Score: 0.5501
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.015523
    • TAT(Tat/SPI): 0.001531
    • LIPO(Sec/SPII): 0.001817
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MANIKSAIKRVKTTEKAEARNISQKSAMRTAVKNAKTAVSNNADNKNELVSLAVKLVDKAAQSNLIHSNKADRIKSQLMTANK

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2]
  • quantitative data / protein copy number per cell: 1134 [3]
  • interaction partners:
    SACOL1637(dnaK)molecular chaperone DnaK  [4] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [4] (data from MRSA252)
    SACOL1782(fhs)formate--tetrahydrofolate ligase  [4] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [4] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [4] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [4] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [4] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [4] (data from MRSA252)
    SACOL1727(infC)translation initiation factor IF-3  [4] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [4] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [4] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [4] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [4] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [4] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [4] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [4] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [4] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [4] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [4] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [4] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [4] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [4] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [4] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [4] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [4] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [4] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [4] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [4] (data from MRSA252)
    SACOL1700(rpmA)50S ribosomal protein L27  [4] (data from MRSA252)
    SACOL2112(rpmE2)50S ribosomal protein L31  [4] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [4] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [4] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [4] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [4] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [4] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [4] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [4] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [4] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [4] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [4] (data from MRSA252)
    SACOL1722(tig)trigger factor  [4] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [4] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [4] (data from MRSA252)
    SACOL03035'-nucleotidase  [4] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [4] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [4] (data from MRSA252)
    SACOL1098hypothetical protein  [4] (data from MRSA252)
    SACOL1753universal stress protein  [4] (data from MRSA252)
    SACOL1952ferritins family protein  [4] (data from MRSA252)
    SACOL2072DEAD/DEAH box helicase  [4] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: 8.17 h [5]

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  4. ↑ 4.00 4.01 4.02 4.03 4.04 4.05 4.06 4.07 4.08 4.09 4.10 4.11 4.12 4.13 4.14 4.15 4.16 4.17 4.18 4.19 4.20 4.21 4.22 4.23 4.24 4.25 4.26 4.27 4.28 4.29 4.30 4.31 4.32 4.33 4.34 4.35 4.36 4.37 4.38 4.39 4.40 4.41 4.42 4.43 4.44 4.45 4.46 4.47 4.48 4.49 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  5. ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]