Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS08375 [old locus tag: SACOL1642 ]
- pan locus tag?: SAUPAN004172000
- symbol: SACOL_RS08375
- pan gene symbol?: rpsT
- synonym:
- product: 30S ribosomal protein S20
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS08375 [old locus tag: SACOL1642 ]
- symbol: SACOL_RS08375
- product: 30S ribosomal protein S20
- replicon: chromosome
- strand: +
- coordinates: 1674066..1674317
- length: 252
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGGCAAATATCAAATCTGCAATTAAACGTGTAAAAACAACTGAAAAAGCTGAAGCACGC
AACATTTCACAAAAGAGTGCAATGCGTACAGCAGTTAAAAACGCTAAAACAGCTGTTTCA
AATAACGCTGATAATAAAAATGAATTAGTAAGCTTAGCAGTTAAGTTAGTAGACAAAGCT
GCTCAAAGTAATTTAATACATTCAAACAAAGCTGACCGTATTAAATCACAATTAATGACT
GCAAATAAATAA60
120
180
240
252
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS08375 [old locus tag: SACOL1642 ]
- symbol: SACOL_RS08375
- description: 30S ribosomal protein S20
- length: 83
- theoretical pI: 11.2814
- theoretical MW: 9021.38
- GRAVY: -0.610843
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS20 (TIGR00029; HMM-score: 68)and 1 moreEnergy metabolism Amino acids and amines tryptophan 2,3-dioxygenase (TIGR03036; EC 1.13.11.11; HMM-score: 14.1)
- TheSEED: see SACOL1642
- PFAM: no clan defined Ribosomal_S20p; Ribosomal protein S20 (PF01649; HMM-score: 75.9)and 2 moreUbiquitin (CL0072) UN_NPL4; Nuclear pore localisation protein NPL4 (PF11543; HMM-score: 15.5)BRCT-like (CL0459) RTT107_BRCT_5; Regulator of Ty1 transposition protein 107 BRCT domain (PF16770; HMM-score: 13.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.015523
- TAT(Tat/SPI): 0.001531
- LIPO(Sec/SPII): 0.001817
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MANIKSAIKRVKTTEKAEARNISQKSAMRTAVKNAKTAVSNNADNKNELVSLAVKLVDKAAQSNLIHSNKADRIKSQLMTANK
⊟Experimental data[edit | edit source]
- experimentally validated: see SACOL1642
- protein localization: see SACOL1642
- quantitative data / protein copy number per cell: see SACOL1642
- interaction partners:
SACOL_RS00470 peptidoglycan-binding protein LysM [1] (data from MRSA252) SACOL_RS01040 formate acetyltransferase [1] (data from MRSA252) SACOL_RS01530 5'-nucleotidase, lipoprotein e(P4) family [1] (data from MRSA252) SACOL_RS03025 50S ribosomal protein L11 [1] (data from MRSA252) SACOL_RS03030 50S ribosomal protein L1 [1] (data from MRSA252) SACOL_RS03035 50S ribosomal protein L10 [1] (data from MRSA252) SACOL_RS03040 50S ribosomal protein L7/L12 [1] (data from MRSA252) SACOL_RS03075 elongation factor G [1] (data from MRSA252) SACOL_RS03080 elongation factor Tu [1] (data from MRSA252) SACOL_RS03755 LysR family transcriptional regulator [1] (data from MRSA252) SACOL_RS04310 aldehyde dehydrogenase [1] (data from MRSA252) SACOL_RS04330 enolase [1] (data from MRSA252) SACOL_RS04840 NADH dehydrogenase [1] (data from MRSA252) SACOL_RS05605 ribonuclease J 1 [1] (data from MRSA252) SACOL_RS05640 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) SACOL_RS05645 dihydrolipoyl dehydrogenase [1] (data from MRSA252) SACOL_RS06420 50S ribosomal protein L19 [1] (data from MRSA252) SACOL_RS06505 30S ribosomal protein S2 [1] (data from MRSA252) SACOL_RS06515 elongation factor Ts [1] (data from MRSA252) SACOL_RS06575 translation initiation factor IF-2 [1] (data from MRSA252) SACOL_RS07385 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex [1] (data from MRSA252) SACOL_RS07705 DNA-binding protein HU [1] (data from MRSA252) SACOL_RS08345 molecular chaperone DnaK [1] (data from MRSA252) SACOL_RS08670 50S ribosomal protein L27 [1] (data from MRSA252) SACOL_RS08680 50S ribosomal protein L21 [1] (data from MRSA252) SACOL_RS08795 trigger factor [1] (data from MRSA252) SACOL_RS08830 translation initiation factor IF-3 [1] (data from MRSA252) SACOL_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) SACOL_RS08970 universal stress protein [1] (data from MRSA252) SACOL_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) SACOL_RS09125 formate--tetrahydrofolate ligase [1] (data from MRSA252) SACOL_RS10210 non-heme ferritin [1] (data from MRSA252) SACOL_RS10840 DEAD/DEAH box family ATP-dependent RNA helicase [1] (data from MRSA252) SACOL_RS11050 50S ribosomal protein L31 type B [1] (data from MRSA252) SACOL_RS11615 30S ribosomal protein S9 [1] (data from MRSA252) SACOL_RS11645 50S ribosomal protein L17 [1] (data from MRSA252) SACOL_RS11655 30S ribosomal protein S11 [1] (data from MRSA252) SACOL_RS11685 50S ribosomal protein L15 [1] (data from MRSA252) SACOL_RS11695 30S ribosomal protein S5 [1] (data from MRSA252) SACOL_RS11705 50S ribosomal protein L6 [1] (data from MRSA252) SACOL_RS11720 50S ribosomal protein L5 [1] (data from MRSA252) SACOL_RS11735 30S ribosomal protein S17 [1] (data from MRSA252) SACOL_RS11745 50S ribosomal protein L16 [1] (data from MRSA252) SACOL_RS11750 30S ribosomal protein S3 [1] (data from MRSA252) SACOL_RS11755 50S ribosomal protein L22 [1] (data from MRSA252) SACOL_RS11760 30S ribosomal protein S19 [1] (data from MRSA252) SACOL_RS11765 50S ribosomal protein L2 [1] (data from MRSA252) SACOL_RS11770 50S ribosomal protein L23 [1] (data from MRSA252) SACOL_RS11775 50S ribosomal protein L4 [1] (data from MRSA252) SACOL_RS11780 50S ribosomal protein L3 [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)