Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS08970 [old locus tag: SACOL1753 ]
- pan locus tag?: SAUPAN004355000
- symbol: SACOL_RS08970
- pan gene symbol?: uspA2
- synonym:
- product: universal stress protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS08970 [old locus tag: SACOL1753 ]
- symbol: SACOL_RS08970
- product: universal stress protein
- replicon: chromosome
- strand: +
- coordinates: 1794540..1794953
- length: 414
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_002951 (1794540..1794953) NCBI
- BioCyc: SACOL_RS08970 BioCyc
- MicrobesOnline: see SACOL1753
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGTATAAAAATATATTACTTGGTGTAGACACTCAGTTAAAAAATGAAAAAGCACTAAAA
GAAGTGTCTAAATTAGCTGGCGAAGGTACAGTCGTAACAGTTTTAAACGCAATCAGCGAA
CAAGATGCTCAAGCATCAATTAAAGCAGGTGTTCATTTAAACAAACTTACTGAAGAACGA
AGCAAGCGATTGGAAAAAACACGCAAAGCTTTAGAAGATTATGGTATTGATTATGACCAA
ATAATTGTTCGTGGTAATGCAAAAGAAGAACTATTAAAACATGCTAATAGCGGTAAATAC
GAAATTGTTGTTTTAAGTAACCGTAAAGCAGAAGACAAAAAGAAATTTGTACTTGGAAGT
GTCAGCCACAAAGTAGCAAAACGTGCGACTATCCCTGTATTAATCGTTAAATAA60
120
180
240
300
360
414
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS08970 [old locus tag: SACOL1753 ]
- symbol: SACOL_RS08970
- description: universal stress protein
- length: 137
- theoretical pI: 10.274
- theoretical MW: 15225.6
- GRAVY: -0.394891
⊟Function[edit | edit source]
- TIGRFAM: Unknown function Enzymes of unknown specificity HAD hydrolase, family IIIA (TIGR01662; HMM-score: 14)
- TheSEED: see SACOL1753
- PFAM: HUP (CL0039) Usp; Universal stress protein family (PF00582; HMM-score: 86.3)and 5 moreCBM87 (CL0883) CBM87_Agd3; Agd3 CBM87 (PF25116; HMM-score: 19.4)no clan defined YfjL_C; YfjL-like C-terminal domain (PF24911; HMM-score: 14.4)Dak2; DAK2 domain (PF02734; HMM-score: 14.2)PFK (CL0240) DAGK_cat; Diacylglycerol kinase catalytic domain (PF00781; HMM-score: 13.7)TIM_barrel (CL0036) Pterin_bind; Pterin binding enzyme (PF00809; HMM-score: 13.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9756
- Cytoplasmic Membrane Score: 0.0128
- Cell wall & surface Score: 0.0031
- Extracellular Score: 0.0085
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.014314
- TAT(Tat/SPI): 0.000974
- LIPO(Sec/SPII): 0.000837
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MYKNILLGVDTQLKNEKALKEVSKLAGEGTVVTVLNAISEQDAQASIKAGVHLNKLTEERSKRLEKTRKALEDYGIDYDQIIVRGNAKEELLKHANSGKYEIVVLSNRKAEDKKKFVLGSVSHKVAKRATIPVLIVK
⊟Experimental data[edit | edit source]
- experimentally validated: see SACOL1753
- protein localization: see SACOL1753
- quantitative data / protein copy number per cell: see SACOL1753
- interaction partners:
SACOL_RS11135 (deoA) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) SACOL_RS00030 DNA polymerase III subunit beta [1] (data from MRSA252) SACOL_RS03030 50S ribosomal protein L1 [1] (data from MRSA252) SACOL_RS03035 50S ribosomal protein L10 [1] (data from MRSA252) SACOL_RS03070 30S ribosomal protein S7 [1] (data from MRSA252) SACOL_RS03075 elongation factor G [1] (data from MRSA252) SACOL_RS03080 elongation factor Tu [1] (data from MRSA252) SACOL_RS03755 LysR family transcriptional regulator [1] (data from MRSA252) SACOL_RS04840 NADH dehydrogenase [1] (data from MRSA252) SACOL_RS05185 enoyl-ACP reductase [1] (data from MRSA252) SACOL_RS05710 translational GTPase TypA [1] (data from MRSA252) SACOL_RS06420 50S ribosomal protein L19 [1] (data from MRSA252) SACOL_RS06575 translation initiation factor IF-2 [1] (data from MRSA252) SACOL_RS07385 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex [1] (data from MRSA252) SACOL_RS08680 50S ribosomal protein L21 [1] (data from MRSA252) SACOL_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) SACOL_RS08930 pyruvate kinase [1] (data from MRSA252) SACOL_RS08995 universal stress protein UspA [1] (data from MRSA252) SACOL_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) SACOL_RS11615 30S ribosomal protein S9 [1] (data from MRSA252) SACOL_RS11685 50S ribosomal protein L15 [1] (data from MRSA252) SACOL_RS11755 50S ribosomal protein L22 [1] (data from MRSA252) SACOL_RS11760 30S ribosomal protein S19 [1] (data from MRSA252) SACOL_RS11765 50S ribosomal protein L2 [1] (data from MRSA252) SACOL_RS11770 50S ribosomal protein L23 [1] (data from MRSA252) SACOL_RS11775 50S ribosomal protein L4 [1] (data from MRSA252) SACOL_RS11780 50S ribosomal protein L3 [1] (data from MRSA252) SACOL_RS13915 arginine deiminase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)