Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_001576
- pan locus tag?: SAUPAN004172000
- symbol: rpsT
- pan gene symbol?: rpsT
- synonym:
- product: 30S ribosomal protein S20
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_001576
- symbol: rpsT
- product: 30S ribosomal protein S20
- replicon: chromosome
- strand: +
- coordinates: 1613922..1614173
- length: 252
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGGCAAATATCAAATCTGCAATTAAACGTGTAAAAACAACTGAAAAAGCTGAAGCACGC
AACATTTCACAAAAGAGTGCAATGCGTACAGCAGTTAAAAACGCTAAAACAGCTGTTTCA
AATAACGCTGATAATAAAAATGAATTAGTAAGCTTAGCAGTTAAGTTAGTAGACAAAGCT
GCTCAAAGTAATTTAATACATTCAAACAAAGCTGACCGTATTAAATCACAATTAATGACT
GCAAATAAATAA60
120
180
240
252
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_001576
- symbol: RpsT
- description: 30S ribosomal protein S20
- length: 83
- theoretical pI: 11.2814
- theoretical MW: 9021.38
- GRAVY: -0.610843
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS20 (TIGR00029; HMM-score: 68)and 1 moreEnergy metabolism Amino acids and amines tryptophan 2,3-dioxygenase (TIGR03036; EC 1.13.11.11; HMM-score: 14.1)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: no clan defined Ribosomal_S20p; Ribosomal protein S20 (PF01649; HMM-score: 79.3)and 2 moreUbiquitin (CL0072) UN_NPL4; Nuclear pore localisation protein NPL4 (PF11543; HMM-score: 14)BRCT-like (CL0459) RTT107_BRCT_5; Regulator of Ty1 transposition protein 107 BRCT domain (PF16770; HMM-score: 12.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0.4398
- Cytoplasmic Membrane Score: 0
- Cell wall & surface Score: 0.0101
- Extracellular Score: 0.5501
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.015523
- TAT(Tat/SPI): 0.001531
- LIPO(Sec/SPII): 0.001817
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MANIKSAIKRVKTTEKAEARNISQKSAMRTAVKNAKTAVSNNADNKNELVSLAVKLVDKAAQSNLIHSNKADRIKSQLMTANK
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]