Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1248 [new locus tag: SACOL_RS06380 ]
- pan locus tag?: SAUPAN003520000
- symbol: rnc
- pan gene symbol?: rnc
- synonym:
- product: ribonuclease III
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1248 [new locus tag: SACOL_RS06380 ]
- symbol: rnc
- product: ribonuclease III
- replicon: chromosome
- strand: +
- coordinates: 1255660..1256391
- length: 732
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238577 NCBI
- RefSeq: YP_186108 NCBI
- BioCyc: see SACOL_RS06380
- MicrobesOnline: 912714 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGTCTAAACAAAAGAAAAGTGAGATAGTTAATCGTTTTAGAAAGCGCTTTGATACTAAA
ATGACAGAGTTAGGCTTTACTTATCAAAATATTGATTTATACCAACAAGCATTTTCGCAT
TCGAGTTTTATTAATGATTTTAATATGAATCGTTTAGACCATAATGAGCGTTTAGAGTTT
TTGGGTGATGCGGTATTAGAATTGACGGTTTCACGATATTTATTTGATAAACATCCCAAC
TTGCCAGAAGGGAATTTAACAAAAATGCGTGCCACTATTGTATGTGAGCCCTCACTTGTA
ATATTTGCGAATAAAATTGGATTGAACGAAATGATTTTACTTGGTAAAGGTGAAGAGAAA
ACAGGGGGACGTACAAGACCATCATTAATATCAGATGCATTCGAAGCATTTATTGGGGCA
TTGTATTTGGATCAAGGACTAGATATAGTTTGGAAATTTGCTGAGAAAGTCATTTTCCCA
CATGTAGAACAAAATGAGTTATTAGGCGTGGTAGATTTTAAAACACAATTCCAAGAATAT
GTGCACCAGCAAAATAAAGGTGATGTAACCTATAATTTAATAAAAGAAGAGGGACCGGCA
CATCATCGTCTATTCACTTCAGAAGTTATTCTGCAAGGGGAAGCAATAGCTGAAGGTAAA
GGGAAAACGAAAAAAGAATCAGAACAACGTGCTGCTGAAAGTGCCTATAAGCAATTAAAA
CAAATTAAATAG60
120
180
240
300
360
420
480
540
600
660
720
732
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1248 [new locus tag: SACOL_RS06380 ]
- symbol: Rnc
- description: ribonuclease III
- length: 243
- theoretical pI: 7.23578
- theoretical MW: 27921.6
- GRAVY: -0.493416
⊟Function[edit | edit source]
- reaction: EC 3.1.26.3? ExPASyRibonuclease III Endonucleolytic cleavage to 5'-phosphomonoester
- TIGRFAM: Transcription RNA processing ribonuclease III (TIGR02191; EC 3.1.26.3; HMM-score: 266.4)and 1 moreseadornavirus double-stranded RNA-binding protein (TIGR04238; HMM-score: 17.2)
- TheSEED :
- Ribonuclease III (EC 3.1.26.3)
Cell Division and Cell Cycle Cell Division and Cell Cycle - no subcategory Two cell division clusters relating to chromosome partitioning Ribonuclease III (EC 3.1.26.3)and 1 more - PFAM: RNase_III (CL0539) Ribonucleas_3_3; Ribonuclease-III-like (PF14622; HMM-score: 124.2)and 2 moreRibonuclease_3; Ribonuclease III domain (PF00636; HMM-score: 78.7)DSRM (CL0196) dsrm; Double-stranded RNA binding motif (PF00035; HMM-score: 60.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors: Mg2+
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004111
- TAT(Tat/SPI): 0.000265
- LIPO(Sec/SPII): 0.000429
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSKQKKSEIVNRFRKRFDTKMTELGFTYQNIDLYQQAFSHSSFINDFNMNRLDHNERLEFLGDAVLELTVSRYLFDKHPNLPEGNLTKMRATIVCEPSLVIFANKIGLNEMILLGKGEEKTGGRTRPSLISDAFEAFIGALYLDQGLDIVWKFAEKVIFPHVEQNELLGVVDFKTQFQEYVHQQNKGDVTYNLIKEEGPAHHRLFTSEVILQGEAIAEGKGKTKKESEQRAAESAYKQLKQIK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 84 [4]
- interaction partners:
SACOL1760 (ackA) acetate kinase [5] (data from MRSA252) SACOL1385 (acnA) aconitate hydratase [5] (data from MRSA252) SACOL0452 (ahpC) alkyl hydroperoxide reductase subunit C [5] (data from MRSA252) SACOL0557 (cysK) cysteine synthase [5] (data from MRSA252) SACOL1637 (dnaK) molecular chaperone DnaK [5] (data from MRSA252) SACOL0842 (eno) phosphopyruvate hydratase [5] (data from MRSA252) SACOL0593 (fusA) elongation factor G [5] (data from MRSA252) SACOL0838 (gapA1) glyceraldehyde 3-phosphate dehydrogenase [5] (data from MRSA252) SACOL0877 (gcvH) glycine cleavage system protein H [5] (data from MRSA252) SACOL2145 (glmS) glucosamine--fructose-6-phosphate aminotransferase [5] (data from MRSA252) SACOL2415 (gpmA) phosphoglyceromutase [5] (data from MRSA252) SACOL0460 (guaB) inosine-5'-monophosphate dehydrogenase [5] (data from MRSA252) SACOL1288 (infB) translation initiation factor IF-2 [5] (data from MRSA252) SACOL0173 (ipdC) indole-3-pyruvate decarboxylase [5] (data from MRSA252) SACOL0222 (ldh1) L-lactate dehydrogenase [5] (data from MRSA252) SACOL2623 (mqo2) malate:quinone oxidoreductase [5] (data from MRSA252) SACOL0204 (pflB) formate acetyltransferase [5] (data from MRSA252) SACOL0966 (pgi) glucose-6-phosphate isomerase [5] (data from MRSA252) SACOL1091 (ptsH) phosphocarrier protein HPr [5] (data from MRSA252) SACOL1745 (pyk) pyruvate kinase [5] (data from MRSA252) SACOL2227 (rplE) 50S ribosomal protein L5 [5] (data from MRSA252) SACOL2224 (rplF) 50S ribosomal protein L6 [5] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [5] (data from MRSA252) SACOL2220 (rplO) 50S ribosomal protein L15 [5] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [5] (data from MRSA252) SACOL2237 (rplW) 50S ribosomal protein L23 [5] (data from MRSA252) SACOL1769 (rpsD) 30S ribosomal protein S4 [5] (data from MRSA252) SACOL2222 (rpsE) 30S ribosomal protein S5 [5] (data from MRSA252) SACOL2206 (rpsI) 30S ribosomal protein S9 [5] (data from MRSA252) SACOL2214 (rpsK) 30S ribosomal protein S11 [5] (data from MRSA252) SACOL2230 (rpsQ) 30S ribosomal protein S17 [5] (data from MRSA252) SACOL1831 (tal) translaldolase [5] (data from MRSA252) SACOL1729 (thrS) threonyl-tRNA synthetase [5] (data from MRSA252) SACOL1722 (tig) trigger factor [5] (data from MRSA252) SACOL1276 (tsf) elongation factor Ts [5] (data from MRSA252) SACOL0594 (tuf) elongation factor Tu [5] (data from MRSA252) SACOL0564 pyridoxal biosynthesis lyase PdxS [5] (data from MRSA252) SACOL0599 hypothetical protein [5] (data from MRSA252) SACOL0944 NADH dehydrogenase [5] (data from MRSA252) SACOL1437 CSD family cold shock protein [5] (data from MRSA252) SACOL1759 universal stress protein [5] (data from MRSA252) SACOL2173 alkaline shock protein 23 [5] (data from MRSA252) SACOL2569 1-pyrroline-5-carboxylate dehydrogenase [5] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 5.32 5.33 5.34 5.35 5.36 5.37 5.38 5.39 5.40 5.41 5.42 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)