From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1248 [new locus tag: SACOL_RS06380 ]
  • pan locus tag?: SAUPAN003520000
  • symbol: rnc
  • pan gene symbol?: rnc
  • synonym:
  • product: ribonuclease III

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1248 [new locus tag: SACOL_RS06380 ]
  • symbol: rnc
  • product: ribonuclease III
  • replicon: chromosome
  • strand: +
  • coordinates: 1255660..1256391
  • length: 732
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTCTAAACAAAAGAAAAGTGAGATAGTTAATCGTTTTAGAAAGCGCTTTGATACTAAA
    ATGACAGAGTTAGGCTTTACTTATCAAAATATTGATTTATACCAACAAGCATTTTCGCAT
    TCGAGTTTTATTAATGATTTTAATATGAATCGTTTAGACCATAATGAGCGTTTAGAGTTT
    TTGGGTGATGCGGTATTAGAATTGACGGTTTCACGATATTTATTTGATAAACATCCCAAC
    TTGCCAGAAGGGAATTTAACAAAAATGCGTGCCACTATTGTATGTGAGCCCTCACTTGTA
    ATATTTGCGAATAAAATTGGATTGAACGAAATGATTTTACTTGGTAAAGGTGAAGAGAAA
    ACAGGGGGACGTACAAGACCATCATTAATATCAGATGCATTCGAAGCATTTATTGGGGCA
    TTGTATTTGGATCAAGGACTAGATATAGTTTGGAAATTTGCTGAGAAAGTCATTTTCCCA
    CATGTAGAACAAAATGAGTTATTAGGCGTGGTAGATTTTAAAACACAATTCCAAGAATAT
    GTGCACCAGCAAAATAAAGGTGATGTAACCTATAATTTAATAAAAGAAGAGGGACCGGCA
    CATCATCGTCTATTCACTTCAGAAGTTATTCTGCAAGGGGAAGCAATAGCTGAAGGTAAA
    GGGAAAACGAAAAAAGAATCAGAACAACGTGCTGCTGAAAGTGCCTATAAGCAATTAAAA
    CAAATTAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    732

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1248 [new locus tag: SACOL_RS06380 ]
  • symbol: Rnc
  • description: ribonuclease III
  • length: 243
  • theoretical pI: 7.23578
  • theoretical MW: 27921.6
  • GRAVY: -0.493416

Function[edit | edit source]

  • reaction:
    EC 3.1.26.3?  ExPASy
    Ribonuclease III Endonucleolytic cleavage to 5'-phosphomonoester
  • TIGRFAM:
    Genetic information processing Transcription RNA processing ribonuclease III (TIGR02191; EC 3.1.26.3; HMM-score: 266.4)
    and 1 more
    seadornavirus double-stranded RNA-binding protein (TIGR04238; HMM-score: 17.2)
  • TheSEED  :
    • Ribonuclease III (EC 3.1.26.3)
    Cell Division and Cell Cycle Cell Division and Cell Cycle - no subcategory Two cell division clusters relating to chromosome partitioning  Ribonuclease III (EC 3.1.26.3)
    and 1 more
    RNA Metabolism RNA processing and modification RNA processing and degradation, bacterial  Ribonuclease III (EC 3.1.26.3)
  • PFAM:
    RNase_III (CL0539) Ribonucleas_3_3; Ribonuclease-III-like (PF14622; HMM-score: 129.5)
    and 4 more
    Ribonuclease_3; Ribonuclease III domain (PF00636; HMM-score: 93.1)
    DSRM (CL0196) dsrm; Double-stranded RNA binding motif (PF00035; HMM-score: 64.9)
    RNase_III (CL0539) RM44_endonuclase; Large ribosomal subunit protein mL44, endonuclease domain (PF22935; HMM-score: 32.3)
    DSRM (CL0196) DSRM_2; dsRNA binding domain (PF24995; HMM-score: 18.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9968
    • Cytoplasmic Membrane Score: 0.0006
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0025
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004111
    • TAT(Tat/SPI): 0.000265
    • LIPO(Sec/SPII): 0.000429
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSKQKKSEIVNRFRKRFDTKMTELGFTYQNIDLYQQAFSHSSFINDFNMNRLDHNERLEFLGDAVLELTVSRYLFDKHPNLPEGNLTKMRATIVCEPSLVIFANKIGLNEMILLGKGEEKTGGRTRPSLISDAFEAFIGALYLDQGLDIVWKFAEKVIFPHVEQNELLGVVDFKTQFQEYVHQQNKGDVTYNLIKEEGPAHHRLFTSEVILQGEAIAEGKGKTKKESEQRAAESAYKQLKQIK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 84 [4]
  • interaction partners:
    SACOL1760(ackA)acetate kinase  [5] (data from MRSA252)
    SACOL1385(acnA)aconitate hydratase  [5] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [5] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [5] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [5] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [5] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [5] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [5] (data from MRSA252)
    SACOL0877(gcvH)glycine cleavage system protein H  [5] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [5] (data from MRSA252)
    SACOL2415(gpmA)phosphoglyceromutase  [5] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [5] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [5] (data from MRSA252)
    SACOL0173(ipdC)indole-3-pyruvate decarboxylase  [5] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [5] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [5] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [5] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [5] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [5] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [5] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [5] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [5] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [5] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [5] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [5] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [5] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [5] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [5] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [5] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [5] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [5] (data from MRSA252)
    SACOL1831(tal)translaldolase  [5] (data from MRSA252)
    SACOL1729(thrS)threonyl-tRNA synthetase  [5] (data from MRSA252)
    SACOL1722(tig)trigger factor  [5] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [5] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [5] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [5] (data from MRSA252)
    SACOL0599hypothetical protein  [5] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [5] (data from MRSA252)
    SACOL1437CSD family cold shock protein  [5] (data from MRSA252)
    SACOL1759universal stress protein  [5] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [5] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [5] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 5.32 5.33 5.34 5.35 5.36 5.37 5.38 5.39 5.40 5.41 5.42 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]