From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0564 [new locus tag: SACOL_RS02930 ]
  • pan locus tag?: SAUPAN002283000
  • symbol: SACOL0564
  • pan gene symbol?: pdxS
  • synonym:
  • product: pyridoxal biosynthesis lyase PdxS

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0564 [new locus tag: SACOL_RS02930 ]
  • symbol: SACOL0564
  • product: pyridoxal biosynthesis lyase PdxS
  • replicon: chromosome
  • strand: +
  • coordinates: 584965..585852
  • length: 888
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAGTAAAATTATTGGATCAGACAGAGTCAAAAGAGGTATGGCTGAAATGCAAAAAGGC
    GGCGTTATTATGGATGTCGTTAATGCTGAGCAAGCAAGAATTGCAGAAGAAGCTGGCGCG
    GTAGCAGTTATGGCATTAGAACGAGTACCTTCTGATATTAGAGCTGCTGGTGGTGTTGCA
    CGTATGGCAAACCCTAAAATTGTAGAAGAAGTAATGAATGCTGTTTCTATTCCAGTCATG
    GCTAAAGCACGTATTGGTCATATCACTGAAGCAAGAGTATTAGAGGCGATGGGTGTTGAC
    TATATTGATGAATCAGAAGTGTTAACACCAGCAGATGAGGAATATCACTTAAGAAAAGAT
    CAATTTACAGTACCATTTGTATGTGGATGTCGTAATTTAGGTGAAGCTGCGCGTAGAATT
    GGTGAAGGTGCTGCTATGTTACGTACTAAAGGTGAACCAGGTACAGGTAATATTGTTGAA
    GCTGTAAGACATATGAGACAAGTTAATTCAGAAGTTAGTCGATTGACTGTAATGAATGAT
    GATGAGATTATGACTTTTGCGAAAGATATCGGTGCGCCTTATGAAATTTTAAAACAAATT
    AAAGACAATGGTCGTTTACCGGTAGTTAACTTTGCAGCTGGTGGCGTTGCGACTCCTCAA
    GATGCTGCTTTAATGATGGAATTAGGTGCTGACGGTGTATTCGTTGGATCAGGTATTTTT
    AAATCAGAAGATCCAGAAAAATTTGCTAAAGCAATTGTTCAAGCAACAACACATTACCAA
    GACTATGAACTAATTGGAAGATTAGCAAGTGAACTTGGCACTGCTATGAAAGGTTTAGAT
    ATCAATCAATTATCATTAGAAGAACGTATGCAAGAGCGTGGTTGGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    888

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL0564 [new locus tag: SACOL_RS02930 ]
  • symbol: SACOL0564
  • description: pyridoxal biosynthesis lyase PdxS
  • length: 295
  • theoretical pI: 4.83393
  • theoretical MW: 31992.6
  • GRAVY: -0.130847

⊟Function[edit | edit source]

  • reaction:
    EC 4.3.3.6?  ExPASy
    Pyridoxal 5'-phosphate synthase (glutamine hydrolyzing) D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine = pyridoxal 5'-phosphate + L-glutamate + 3 H2O + phosphate
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine pyridoxal 5'-phosphate synthase, synthase subunit Pdx1 (TIGR00343; HMM-score: 505.6)
    and 15 more
    Unknown function General putative TIM-barrel protein, nifR3 family (TIGR00737; HMM-score: 32.5)
    putative enoyl-[acyl-carrier-protein] reductase II (TIGR03151; EC 1.3.1.-; HMM-score: 23.2)
    glycosyl amidation-associated protein WbuZ (TIGR03572; HMM-score: 20.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiamine-phosphate diphosphorylase (TIGR00693; EC 2.5.1.3; HMM-score: 19.7)
    Metabolism Energy metabolism Glycolysis/gluconeogenesis triose-phosphate isomerase (TIGR00419; EC 5.3.1.1; HMM-score: 18.2)
    3-hexulose-6-phosphate synthase (TIGR03128; EC 4.1.2.43; HMM-score: 18)
    Metabolism Amino acid biosynthesis Histidine family 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase (TIGR00007; EC 5.3.1.16; HMM-score: 17.1)
    Metabolism Amino acid biosynthesis Aromatic amino acid family tryptophan synthase, alpha subunit (TIGR00262; EC 4.2.1.20; HMM-score: 16.7)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis orotidine 5'-phosphate decarboxylase (TIGR01740; EC 4.1.1.23; HMM-score: 16.4)
    dihydroorotate dehydrogenase family protein (TIGR01037; EC 1.3.-.-; HMM-score: 15.8)
    Unknown function General hisA/hisF family protein (TIGR00734; HMM-score: 15.6)
    methylmalonyl-CoA mutase C-terminal domain (TIGR00640; HMM-score: 15.1)
    Metabolism Amino acid biosynthesis Histidine family imidazoleglycerol phosphate synthase, cyclase subunit (TIGR00735; HMM-score: 15.1)
    geranylgeranylglyceryl phosphate synthase family protein (TIGR01768; EC 2.5.1.-; HMM-score: 13.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other isopentenyl-diphosphate delta-isomerase, type 2 (TIGR02151; EC 5.3.3.2; HMM-score: 12.7)
  • TheSEED  :
    • Pyridoxine biosynthesis glutamine amidotransferase, synthase subunit (EC 2.4.2.-)
    Cofactors, Vitamins, Prosthetic Groups, Pigments Pyridoxine Pyridoxin (Vitamin B6) Biosynthesis  Pyridoxine biosynthesis glutamine amidotransferase, synthase subunit (EC 2.4.2.-)
  • PFAM:
    TIM_barrel (CL0036) SOR_SNZ; SOR/SNZ family (PF01680; HMM-score: 356.8)
    and 12 more
    ThiG; Thiazole biosynthesis protein ThiG (PF05690; HMM-score: 46.9)
    Dus; Dihydrouridine synthase (Dus) (PF01207; HMM-score: 28.8)
    IGPS; Indole-3-glycerol phosphate synthase (PF00218; HMM-score: 24.4)
    His_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 22.8)
    NMO; Nitronate monooxygenase (PF03060; HMM-score: 22.3)
    NanE; Putative N-acetylmannosamine-6-phosphate epimerase (PF04131; HMM-score: 21.1)
    OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 20.4)
    DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 17.3)
    IMPDH; IMP dehydrogenase / GMP reductase domain (PF00478; HMM-score: 15.5)
    FMN_dh; FMN-dependent dehydrogenase (PF01070; HMM-score: 15.5)
    TMP-TENI; Thiamine monophosphate synthase (PF02581; HMM-score: 15)
    no clan defined Phage_Cox; Regulatory phage protein cox (PF10743; HMM-score: 13.5)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004504
    • TAT(Tat/SPI): 0.001201
    • LIPO(Sec/SPII): 0.000466
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MSKIIGSDRVKRGMAEMQKGGVIMDVVNAEQARIAEEAGAVAVMALERVPSDIRAAGGVARMANPKIVEEVMNAVSIPVMAKARIGHITEARVLEAMGVDYIDESEVLTPADEEYHLRKDQFTVPFVCGCRNLGEAARRIGEGAAMLRTKGEPGTGNIVEAVRHMRQVNSEVSRLTVMNDDEIMTFAKDIGAPYEILKQIKDNGRLPVVNFAAGGVATPQDAALMMELGADGVFVGSGIFKSEDPEKFAKAIVQATTHYQDYELIGRLASELGTAMKGLDINQLSLEERMQERGW

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3] [4]
  • quantitative data / protein copy number per cell: 2867 [5]
  • interaction partners:
    SACOL1637(dnaK)molecular chaperone DnaK  [6] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [6] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [6] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [6] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [6] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [6] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [6] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [6] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [6] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [6] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [6] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [6] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [6] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [6] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [6] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [6] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [6] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [6] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [6] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [6] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [6] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [6] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [6] (data from MRSA252)
    SACOL2112(rpmE2)50S ribosomal protein L31  [6] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [6] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [6] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [6] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [6] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [6] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [6] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [6] (data from MRSA252)
    SACOL1759universal stress protein  [6] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [6] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • data available for N315

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 6.15 6.16 6.17 6.18 6.19 6.20 6.21 6.22 6.23 6.24 6.25 6.26 6.27 6.28 6.29 6.30 6.31 6.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SACOL0564&oldid=97270"