Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0564 [new locus tag: SACOL_RS02930 ]
- pan locus tag?: SAUPAN002283000
- symbol: SACOL0564
- pan gene symbol?: pdxS
- synonym:
- product: pyridoxal biosynthesis lyase PdxS
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0564 [new locus tag: SACOL_RS02930 ]
- symbol: SACOL0564
- product: pyridoxal biosynthesis lyase PdxS
- replicon: chromosome
- strand: +
- coordinates: 584965..585852
- length: 888
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3237614 NCBI
- RefSeq: YP_185452 NCBI
- BioCyc: see SACOL_RS02930
- MicrobesOnline: 912045 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGAGTAAAATTATTGGATCAGACAGAGTCAAAAGAGGTATGGCTGAAATGCAAAAAGGC
GGCGTTATTATGGATGTCGTTAATGCTGAGCAAGCAAGAATTGCAGAAGAAGCTGGCGCG
GTAGCAGTTATGGCATTAGAACGAGTACCTTCTGATATTAGAGCTGCTGGTGGTGTTGCA
CGTATGGCAAACCCTAAAATTGTAGAAGAAGTAATGAATGCTGTTTCTATTCCAGTCATG
GCTAAAGCACGTATTGGTCATATCACTGAAGCAAGAGTATTAGAGGCGATGGGTGTTGAC
TATATTGATGAATCAGAAGTGTTAACACCAGCAGATGAGGAATATCACTTAAGAAAAGAT
CAATTTACAGTACCATTTGTATGTGGATGTCGTAATTTAGGTGAAGCTGCGCGTAGAATT
GGTGAAGGTGCTGCTATGTTACGTACTAAAGGTGAACCAGGTACAGGTAATATTGTTGAA
GCTGTAAGACATATGAGACAAGTTAATTCAGAAGTTAGTCGATTGACTGTAATGAATGAT
GATGAGATTATGACTTTTGCGAAAGATATCGGTGCGCCTTATGAAATTTTAAAACAAATT
AAAGACAATGGTCGTTTACCGGTAGTTAACTTTGCAGCTGGTGGCGTTGCGACTCCTCAA
GATGCTGCTTTAATGATGGAATTAGGTGCTGACGGTGTATTCGTTGGATCAGGTATTTTT
AAATCAGAAGATCCAGAAAAATTTGCTAAAGCAATTGTTCAAGCAACAACACATTACCAA
GACTATGAACTAATTGGAAGATTAGCAAGTGAACTTGGCACTGCTATGAAAGGTTTAGAT
ATCAATCAATTATCATTAGAAGAACGTATGCAAGAGCGTGGTTGGTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
888
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0564 [new locus tag: SACOL_RS02930 ]
- symbol: SACOL0564
- description: pyridoxal biosynthesis lyase PdxS
- length: 295
- theoretical pI: 4.83393
- theoretical MW: 31992.6
- GRAVY: -0.130847
⊟Function[edit | edit source]
- reaction: EC 4.3.3.6? ExPASyPyridoxal 5'-phosphate synthase (glutamine hydrolyzing) D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine = pyridoxal 5'-phosphate + L-glutamate + 3 H2O + phosphate
- TIGRFAM: Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine pyridoxal 5'-phosphate synthase, synthase subunit Pdx1 (TIGR00343; HMM-score: 505.6)and 15 moreUnknown function General putative TIM-barrel protein, nifR3 family (TIGR00737; HMM-score: 32.5)putative enoyl-[acyl-carrier-protein] reductase II (TIGR03151; EC 1.3.1.-; HMM-score: 23.2)glycosyl amidation-associated protein WbuZ (TIGR03572; HMM-score: 20.5)Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiamine-phosphate diphosphorylase (TIGR00693; EC 2.5.1.3; HMM-score: 19.7)Energy metabolism Glycolysis/gluconeogenesis triose-phosphate isomerase (TIGR00419; EC 5.3.1.1; HMM-score: 18.2)3-hexulose-6-phosphate synthase (TIGR03128; EC 4.1.2.43; HMM-score: 18)Amino acid biosynthesis Histidine family 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase (TIGR00007; EC 5.3.1.16; HMM-score: 17.1)Amino acid biosynthesis Aromatic amino acid family tryptophan synthase, alpha subunit (TIGR00262; EC 4.2.1.20; HMM-score: 16.7)Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis orotidine 5'-phosphate decarboxylase (TIGR01740; EC 4.1.1.23; HMM-score: 16.4)dihydroorotate dehydrogenase family protein (TIGR01037; EC 1.3.-.-; HMM-score: 15.8)Unknown function General hisA/hisF family protein (TIGR00734; HMM-score: 15.6)methylmalonyl-CoA mutase C-terminal domain (TIGR00640; HMM-score: 15.1)Amino acid biosynthesis Histidine family imidazoleglycerol phosphate synthase, cyclase subunit (TIGR00735; HMM-score: 15.1)geranylgeranylglyceryl phosphate synthase family protein (TIGR01768; EC 2.5.1.-; HMM-score: 13.4)Biosynthesis of cofactors, prosthetic groups, and carriers Other isopentenyl-diphosphate delta-isomerase, type 2 (TIGR02151; EC 5.3.3.2; HMM-score: 12.7)
- TheSEED :
- Pyridoxine biosynthesis glutamine amidotransferase, synthase subunit (EC 2.4.2.-)
- PFAM: TIM_barrel (CL0036) SOR_SNZ; SOR/SNZ family (PF01680; HMM-score: 356.9)and 14 moreThiG; Thiazole biosynthesis protein ThiG (PF05690; HMM-score: 47.9)Dus; Dihydrouridine synthase (Dus) (PF01207; HMM-score: 28.1)IGPS; Indole-3-glycerol phosphate synthase (PF00218; HMM-score: 23.8)His_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 23.7)NMO; Nitronate monooxygenase (PF03060; HMM-score: 22.6)OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 20.9)NanE; Putative N-acetylmannosamine-6-phosphate epimerase (PF04131; HMM-score: 19.9)TMP-TENI; Thiamine monophosphate synthase (PF02581; HMM-score: 17.5)DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 17.3)TetR_C (CL0174) TetR_C_27; Tetracyclin repressor-like, C-terminal domain (PF17935; HMM-score: 17)TIM_barrel (CL0036) FMN_dh; FMN-dependent dehydrogenase (PF01070; HMM-score: 15.6)IMPDH; IMP dehydrogenase / GMP reductase domain (PF00478; HMM-score: 14.7)Leu-IlvD (CL0364) Peptidase_S66C; LD-carboxypeptidase C-terminal domain (PF17676; HMM-score: 13.3)TIM_barrel (CL0036) TIM; Triosephosphate isomerase (PF00121; HMM-score: 13.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.6392
- Cytoplasmic Membrane Score: 0.3101
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0506
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004504
- TAT(Tat/SPI): 0.001201
- LIPO(Sec/SPII): 0.000466
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSKIIGSDRVKRGMAEMQKGGVIMDVVNAEQARIAEEAGAVAVMALERVPSDIRAAGGVARMANPKIVEEVMNAVSIPVMAKARIGHITEARVLEAMGVDYIDESEVLTPADEEYHLRKDQFTVPFVCGCRNLGEAARRIGEGAAMLRTKGEPGTGNIVEAVRHMRQVNSEVSRLTVMNDDEIMTFAKDIGAPYEILKQIKDNGRLPVVNFAAGGVATPQDAALMMELGADGVFVGSGIFKSEDPEKFAKAIVQATTHYQDYELIGRLASELGTAMKGLDINQLSLEERMQERGW
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3] [4]
- quantitative data / protein copy number per cell: 2867 [5]
- interaction partners:
SACOL1637 (dnaK) molecular chaperone DnaK [6] (data from MRSA252) SACOL0842 (eno) phosphopyruvate hydratase [6] (data from MRSA252) SACOL0593 (fusA) elongation factor G [6] (data from MRSA252) SACOL1513 (hup) DNA-binding protein HU [6] (data from MRSA252) SACOL1741 (icd) isocitrate dehydrogenase [6] (data from MRSA252) SACOL2623 (mqo2) malate:quinone oxidoreductase [6] (data from MRSA252) SACOL1102 (pdhA) pyruvate dehydrogenase complex E1 component subunit alpha [6] (data from MRSA252) SACOL1103 (pdhB) pyruvate dehydrogenase complex E1 component subunit beta [6] (data from MRSA252) SACOL1104 (pdhC) branched-chain alpha-keto acid dehydrogenase E2 [6] (data from MRSA252) SACOL1105 (pdhD) dihydrolipoamide dehydrogenase [6] (data from MRSA252) SACOL0204 (pflB) formate acetyltransferase [6] (data from MRSA252) SACOL1745 (pyk) pyruvate kinase [6] (data from MRSA252) SACOL0584 (rplA) 50S ribosomal protein L1 [6] (data from MRSA252) SACOL2236 (rplB) 50S ribosomal protein L2 [6] (data from MRSA252) SACOL2227 (rplE) 50S ribosomal protein L5 [6] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [6] (data from MRSA252) SACOL0586 (rplL) 50S ribosomal protein L7/L12 [6] (data from MRSA252) SACOL2220 (rplO) 50S ribosomal protein L15 [6] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [6] (data from MRSA252) SACOL1725 (rplT) 50S ribosomal protein L20 [6] (data from MRSA252) SACOL1702 (rplU) 50S ribosomal protein L21 [6] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [6] (data from MRSA252) SACOL2237 (rplW) 50S ribosomal protein L23 [6] (data from MRSA252) SACOL2112 (rpmE2) 50S ribosomal protein L31 [6] (data from MRSA252) SACOL2213 (rpoA) DNA-directed RNA polymerase subunit alpha [6] (data from MRSA252) SACOL2233 (rpsC) 30S ribosomal protein S3 [6] (data from MRSA252) SACOL2214 (rpsK) 30S ribosomal protein S11 [6] (data from MRSA252) SACOL1449 (sucA) 2-oxoglutarate dehydrogenase E1 component [6] (data from MRSA252) SACOL1448 (sucB) dihydrolipoamide succinyltransferase [6] (data from MRSA252) SACOL0594 (tuf) elongation factor Tu [6] (data from MRSA252) SACOL0973 fumarylacetoacetate hydrolase [6] (data from MRSA252) SACOL1759 universal stress protein [6] (data from MRSA252) SACOL2173 alkaline shock protein 23 [6] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
J Proteome Res: 2010, 9(3);1579-90
[PubMed:20108986] [WorldCat.org] [DOI] (I p) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 6.15 6.16 6.17 6.18 6.19 6.20 6.21 6.22 6.23 6.24 6.25 6.26 6.27 6.28 6.29 6.30 6.31 6.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)