From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0351 [new locus tag: SA_RS02005 ]
  • symbol: SA0351
  • product: GTP-dependent nucleic acid-binding protein EngD
  • replicon: chromosome
  • strand: +
  • coordinates: 410257..411354
  • length: 1098
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGGCTTTAACAGCAGGTATCGTTGGCTTACCAAACGTTGGTAAATCAACATTATTTAAT
    GCAATTACAAAGGCGGGTGCCTTGGCAGCAAACTATCCGTTCGCAACTATAGACCCAAAT
    GTGGGTATTGTAGAAGTGCCAGATGCAAGACTACTTAAATTAGAAGAAATGGTTCAACCT
    AAAAAAACATTACCTACTACATTTGAATTTACAGATATTGCCGGAATTGTTAAAGGTGCT
    TCTAAAGGTGAAGGTTTAGGTAATAAATTCTTATCACATATTAGAGAAGTAGATGCAATT
    TGTCAGGTTGTTCGTGCTTTTGACGATGATAATGTAACACATGTAGCTGGTCGAGTTGAT
    CCAATTGATGACATCGAAGTTATCAATATGGAATTAGTACTTGCAGACTTAGAATCAGTT
    GAAAAACGCTTACCTAGAATTGAAAAATTGGCACGTCAAAAAGATAAGACTGCTGAAATG
    GAAGTGCGTATTTTAACAACTATTAAAGAAGCTTTAGAAAATGGTAAACCCGCTCGTAGT
    ATTGACTTTAATGAAGAAGACCAAAAATGGGTGAATCAAGCGCAATTACTGACTTCTAAA
    AAAATGCTTTATATCGCTAATGTTGGTGAAGATGAAATTGGTGATGATGATAATGATAAA
    GTAAAAGCGATTCGTGAATATGCAGCGCAAGAAGACTCTGAAGTGATTGTTATTAGTGCA
    AAAATTGAAGAAGAAATTGCTACATTAGATGATGAAGATAAAGAAATGTTCTTAGAAGAT
    TTAGGTATCGAAGAACCAGGATTAGATCGATTAATTAGAACAACTTATGAATTATTAGGA
    TTATCAACATATTTTACTGCTGGTGTGCAAGAAGTACGTGCTTGGACATTTAAACAAGGT
    ATGACTGCACCTCAATGTGCTGGTATCATTCATACTGATTTTGAACGTGGATTTATCCGT
    GCCGAAGTAACAAGTTATGATGACTATGTACAATATGGCGGCGAAAGTGGCGCTAAAGAA
    GCGGGCAGACAACGATTAGAAGGTAAAGAATATATTATGCAAGATGGCGATATCGTTCAT
    TTCAGATTTAATGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1098

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0351 [new locus tag: SA_RS02005 ]
  • symbol: SA0351
  • description: GTP-dependent nucleic acid-binding protein EngD
  • length: 365
  • theoretical pI: 4.33991
  • theoretical MW: 40594.7
  • GRAVY: -0.288767

Function[edit | edit source]

  • TIGRFAM:
    Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 516.4)
    and 11 more
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 80.9)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 37.8)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 33.3)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 30.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 27.9)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 24.4)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 20.9)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 19.2)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 14.1)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 14.1)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13.5)
  • TheSEED  :
    • GTP-binding and nucleic acid-binding protein YchF
    Protein Metabolism Protein biosynthesis Universal GTPases  GTP-binding and nucleic acid-binding protein YchF
  • PFAM:
    Ubiquitin (CL0072) YchF-GTPase_C; Protein of unknown function (DUF933) (PF06071; HMM-score: 135.8)
    and 3 more
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 81.4)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 32.7)
    Ubiquitin (CL0072) TGS; TGS domain (PF02824; HMM-score: 14.6)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9983
    • Cytoplasmic Membrane Score: 0.0002
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0015
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 0.67
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.140842
    • TAT(Tat/SPI): 0.037919
    • LIPO(Sec/SPII): 0.009151
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MALTAGIVGLPNVGKSTLFNAITKAGALAANYPFATIDPNVGIVEVPDARLLKLEEMVQPKKTLPTTFEFTDIAGIVKGASKGEGLGNKFLSHIREVDAICQVVRAFDDDNVTHVAGRVDPIDDIEVINMELVLADLESVEKRLPRIEKLARQKDKTAEMEVRILTTIKEALENGKPARSIDFNEEDQKWVNQAQLLTSKKMLYIANVGEDEIGDDDNDKVKAIREYAAQEDSEVIVISAKIEEEIATLDDEDKEMFLEDLGIEEPGLDRLIRTTYELLGLSTYFTAGVQEVRAWTFKQGMTAPQCAGIIHTDFERGFIRAEVTSYDDYVQYGGESGAKEAGRQRLEGKEYIMQDGDIVHFRFNV

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [2] (data from MRSA252)
    SA1533(ackA)acetate kinase  [2] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [2] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [2] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [2] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [2] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [2] (data from MRSA252)
    SA1887(ddl)D-alanyl-alanine synthetase A  [2] (data from MRSA252)
    SA0002(dnaN)DNA polymerase III subunit beta  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA0545(eutD)phosphotransacetylase  [2] (data from MRSA252)
    SA1074(fabG)3-oxoacyl-ACP reductase  [2] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [2] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [2] (data from MRSA252)
    SA0505(fus)elongation factor G  [2] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [2] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [2] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [2] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [2] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [2] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [2] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [2] (data from MRSA252)
    SA0245(ispD)2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [2] (data from MRSA252)
    SA0475(lysS)lysyl-tRNA synthetase  [2] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA1902(murA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [2] (data from MRSA252)
    SA1926(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [2] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [2] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [2] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0730(pgm)phosphoglyceromutase  [2] (data from MRSA252)
    SA0458(prs)ribose-phosphate pyrophosphokinase  [2] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [2] (data from MRSA252)
    SA0935(ptsI)phosphoenolpyruvate-protein phosphatase  [2] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [2] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [2] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA1471(rpmA)50S ribosomal protein L27  [2] (data from MRSA252)
    SA2030(rpmD)50S ribosomal protein L30  [2] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [2] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [2] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [2] (data from MRSA252)
    SA1116(rpsO)30S ribosomal protein S15  [2] (data from MRSA252)
    SA0354(rpsR)30S ribosomal protein S18  [2] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SA0009(serS)seryl-tRNA synthetase  [2] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [2] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [2] (data from MRSA252)
    SA1499(tig)trigger factor  [2] (data from MRSA252)
    SA1177(tkt)transketolase  [2] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [2] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [2] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [2] (data from MRSA252)
    SA0295hypothetical protein  [2] (data from MRSA252)
    SA0468hypothetical protein  [2] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [2] (data from MRSA252)
    SA0537phosphomethylpyrimidine kinase  [2] (data from MRSA252)
    SA0587hypothetical protein  [2] (data from MRSA252)
    SA0637hypothetical protein  [2] (data from MRSA252)
    SA0707hypothetical protein  [2] (data from MRSA252)
    SA0759hypothetical protein  [2] (data from MRSA252)
    SA0774hypothetical protein  [2] (data from MRSA252)
    SA0802hypothetical protein  [2] (data from MRSA252)
    SA0829hypothetical protein  [2] (data from MRSA252)
    SA1271threonine dehydratase  [2] (data from MRSA252)
    SA1528hypothetical protein  [2] (data from MRSA252)
    SA1532hypothetical protein  [2] (data from MRSA252)
    SA1709hypothetical protein  [2] (data from MRSA252)
    SA2327pyruvate oxidase  [2] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [2] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. Jump up to: 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.61 2.62 2.63 2.64 2.65 2.66 2.67 2.68 2.69 2.70 2.71 2.72 2.73 2.74 2.75 2.76 2.77 2.78 2.79 2.80 2.81 2.82 2.83 2.84 2.85 2.86 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]