Jump to navigation
		Jump to search
		
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS06505 [old locus tag: NWMN_1153 ]
- pan locus tag?: SAUPAN003535000
- symbol: NWMN_RS06505
- pan gene symbol?: rbgA
- synonym:
- product: ribosome biogenesis GTPase YlqF
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS06505 [old locus tag: NWMN_1153 ]
- symbol: NWMN_RS06505
- product: ribosome biogenesis GTPase YlqF
- replicon: chromosome
- strand: +
- coordinates: 1265099..1265983
- length: 885
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
 61
 121
 181
 241
 301
 361
 421
 481
 541
 601
 661
 721
 781
 841ATGGTTATTCAATGGTATCCAGGACATATGGCGAAAGCCAAAAGAGAAGTAAGTGAACAA
 TTAAAAAAAGTAGATGTAGTGTTTGAACTAGTAGATGCAAGAATTCCATATAGTTCAAGA
 AACCCTATGATAGATGAAGTTATTAACCAAAAACCACGTGTTGTTATATTAAATAAAAAA
 GATATGTCTAATTTAAATGAGATGTCAAAATGGGAACAATTTTTTATTGATAAAGGATAC
 TATCCTGTATCAGTGGATGCTAAGCACGGTAAAAATTTAAAGAAAGTGGAAGCTGCAGCA
 ATTAAGGCGACTGCTGAAAAATTTGAACGCGAAAAAGCGAAAGGACTTAAACCTAGAGCG
 ATAAGAGCAATGATCGTTGGAATTCCAAATGTTGGTAAATCCACATTAATAAATAAACTG
 GCAAAGCGTAGTATTGCGCAGACTGGTAATAAACCAGGTGTGACCAAACAACAACAATGG
 ATTAAAGTTGGTAATGCATTACAACTATTAGACACACCAGGGATACTTTGGCCTAAATTT
 GAAGATGAAGAAGTCGGTAAGAAGTTGAGTTTAACTGGTGCGATAAAAGATAGTATTGTG
 CACTTAGATGAAGTTGCCATCTATGGATTAAACTTTTTAATTCAAAATGATTTAGCGCGA
 TTAAAGTCACATTATAATATTGAAGTTCCTGAAGATGCAGAAATCATAGCGTGGTTTGAT
 GCGATAGGGAAAAAACGTGGCTTAATTCGACGTGGTAATGAAATTGATTACGAAGCAGTC
 ATTGAACTGATTATTTATGATATTCGAAATGCTAAAATAGGAAATTATTGTTTTGATATT
 TTTAAAGATATGACTGAGGAATTAGCAAATGACGCTAACAATTAA60
 120
 180
 240
 300
 360
 420
 480
 540
 600
 660
 720
 780
 840
 885
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS06505 [old locus tag: NWMN_1153 ]
- symbol: NWMN_RS06505
- description: ribosome biogenesis GTPase YlqF
- length: 294
- theoretical pI: 9.6036
- theoretical MW: 33380.5
- GRAVY: -0.35034
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 364.7)and 16 moreProtein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 72.5)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 54.7)Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 52.5)Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 49.3)Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 43.3)Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 39.4)Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 37)Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 28.5)Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 25.1)Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 23.8)Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 23)Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 21.4)Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)Protein fate Protein and peptide secretion and trafficking signal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 13.1)Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 12.8)
- TheSEED: see NWMN_1153
- PFAM: P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 76.2)and 15 moreFeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 41.5)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 32.3)Dynamin_N; Dynamin family (PF00350; HMM-score: 20.2)Arf; ADP-ribosylation factor family (PF00025; HMM-score: 17.6)AAA_18; AAA domain (PF13238; HMM-score: 16.8)GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 15.4)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 14.3)AIG1; AIG1 family (PF04548; HMM-score: 14.3)Septin; Septin (PF00735; HMM-score: 13.4)Ras; Ras family (PF00071; HMM-score: 13.1)RNA_helicase; RNA helicase (PF00910; HMM-score: 12.8)Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 12.8)TniB; Bacterial TniB protein (PF05621; HMM-score: 12.6)SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 12.5)AAA_25; AAA domain (PF13481; HMM-score: 12.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
 
- DeepLocPro: Cytoplasmic- Cytoplasmic Score: 0.9575
- Cytoplasmic Membrane Score: 0.0074
- Cell wall & surface Score: 0
- Extracellular Score: 0.0351
 
- LocateP:
- SignalP: no predicted signal peptide- SP(Sec/SPI): 0.002066
- TAT(Tat/SPI): 0.00021
- LIPO(Sec/SPII): 0.000572
 
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MVIQWYPGHMAKAKREVSEQLKKVDVVFELVDARIPYSSRNPMIDEVINQKPRVVILNKKDMSNLNEMSKWEQFFIDKGYYPVSVDAKHGKNLKKVEAAAIKATAEKFEREKAKGLKPRAIRAMIVGIPNVGKSTLINKLAKRSIAQTGNKPGVTKQQQWIKVGNALQLLDTPGILWPKFEDEEVGKKLSLTGAIKDSIVHLDEVAIYGLNFLIQNDLARLKSHYNIEVPEDAEIIAWFDAIGKKRGLIRRGNEIDYEAVIELIIYDIRNAKIGNYCFDIFKDMTEELANDANN
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners: NWMN_RS11780 (deoA) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) NWMN_RS00315 peptidoglycan-binding protein LysM [1] (data from MRSA252) NWMN_RS00885 formate acetyltransferase [1] (data from MRSA252) NWMN_RS01375 5'-nucleotidase, lipoprotein e(P4) family [1] (data from MRSA252) NWMN_RS02915 50S ribosomal protein L1 [1] (data from MRSA252) NWMN_RS02920 50S ribosomal protein L10 [1] (data from MRSA252) NWMN_RS02925 50S ribosomal protein L7/L12 [1] (data from MRSA252) NWMN_RS02950 30S ribosomal protein S12 [1] (data from MRSA252) NWMN_RS02960 elongation factor G [1] (data from MRSA252) NWMN_RS02965 elongation factor Tu [1] (data from MRSA252) NWMN_RS04080 preprotein translocase subunit SecA [1] (data from MRSA252) NWMN_RS04590 NADH dehydrogenase [1] (data from MRSA252) NWMN_RS05380 pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) NWMN_RS05385 pyruvate dehydrogenase E1 component subunit beta [1] (data from MRSA252) NWMN_RS05390 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) NWMN_RS05395 dihydrolipoyl dehydrogenase [1] (data from MRSA252) NWMN_RS06210 cell division protein FtsZ [1] (data from MRSA252) NWMN_RS06490 50S ribosomal protein L19 [1] (data from MRSA252) NWMN_RS06575 30S ribosomal protein S2 [1] (data from MRSA252) NWMN_RS07455 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex [1] (data from MRSA252) NWMN_RS07785 DNA-binding protein HU [1] (data from MRSA252) NWMN_RS08350 molecular chaperone DnaK [1] (data from MRSA252) NWMN_RS08685 50S ribosomal protein L21 [1] (data from MRSA252) NWMN_RS08820 50S ribosomal protein L20 [1] (data from MRSA252) NWMN_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) NWMN_RS08930 pyruvate kinase [1] (data from MRSA252) NWMN_RS08935 ATP-dependent 6-phosphofructokinase [1] (data from MRSA252) NWMN_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) NWMN_RS12080 Asp23/Gls24 family envelope stress response protein [1] (data from MRSA252) NWMN_RS12260 30S ribosomal protein S9 [1] (data from MRSA252) NWMN_RS12300 30S ribosomal protein S11 [1] (data from MRSA252) NWMN_RS12330 50S ribosomal protein L15 [1] (data from MRSA252) NWMN_RS12340 30S ribosomal protein S5 [1] (data from MRSA252) NWMN_RS12345 50S ribosomal protein L18 [1] (data from MRSA252) NWMN_RS12350 50S ribosomal protein L6 [1] (data from MRSA252) NWMN_RS12365 50S ribosomal protein L5 [1] (data from MRSA252) NWMN_RS12380 30S ribosomal protein S17 [1] (data from MRSA252) NWMN_RS12390 50S ribosomal protein L16 [1] (data from MRSA252) NWMN_RS12395 30S ribosomal protein S3 [1] (data from MRSA252) NWMN_RS12400 50S ribosomal protein L22 [1] (data from MRSA252) NWMN_RS12410 50S ribosomal protein L2 [1] (data from MRSA252) NWMN_RS12415 50S ribosomal protein L23 [1] (data from MRSA252) NWMN_RS12420 50S ribosomal protein L4 [1] (data from MRSA252) NWMN_RS12425 50S ribosomal protein L3 [1] (data from MRSA252) NWMN_RS14370 malate:quinone oxidoreductase [1] (data from MRSA252) 
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner  
 Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
 J Proteome Res: 2011, 10(3);1139-50
 [PubMed:21166474] [WorldCat.org] [DOI] (I p)