Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1260 [new locus tag: SACOL_RS06435 ]
- pan locus tag?: SAUPAN003535000
- symbol: rbgA
- pan gene symbol?: rbgA
- synonym: ylqF
- product: ribosomal biogenesis GTPase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1260 [new locus tag: SACOL_RS06435 ]
- symbol: rbgA
- product: ribosomal biogenesis GTPase
- replicon: chromosome
- strand: +
- coordinates: 1268908..1269792
- length: 885
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238168 NCBI
- RefSeq: YP_186118 NCBI
- BioCyc: see SACOL_RS06435
- MicrobesOnline: 912724 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGGTTATTCAATGGTATCCAGGACATATGGCGAAAGCCAAAAGAGAAGTAAGTGAACAA
TTAAAAAAAGTAGATGTAGTGTTTGAACTAGTAGATGCAAGAATTCCATATAGTTCAAGA
AACCCTATGATAGATGAAGTTATTAACCAAAAACCACGTGTTGTTATATTAAATAAAAAA
GATATGTCTAATTTAAATGAGATGTCAAAATGGGAACAATTTTTTATTGATAAAGGATAC
TATCCTGTATCAGTGGATGCTAAGCACGGTAAAAATTTAAAGAAAGTGGAAGCTGCAGCA
ATTAAGGCGACTGCTGAAAAATTTGAACGCGAAAAAGCGAAAGGACTTAAACCTAGAGCG
ATAAGAGCAATGATCGTTGGAATTCCAAATGTTGGTAAATCCACATTAATAAATAAACTG
GCAAAGCGTAGTATTGCGCAGACTGGTAATAAACCAGGTGTGACCAAACAACAACAATGG
ATTAAAGTTGGTAATGCATTACAACTATTAGACACACCAGGGATACTTTGGCCTAAATTT
GAAGATGAAGAAGTCGGTAAGAAGTTGAGTTTAACTGGTGCGATAAAAGATAGTATTGTG
CACTTAGATGAAGTTGCCATCTATGGATTAAACTTTTTAATTCAAAATGATTTAGCGCGA
TTAAAGTCACATTATAATATTGAAGTTCCTGAAGATGCAGAAATCATAGCGTGGTTTGAT
GCGATAGGGAAAAAACGTGGCTTAATTCGACGTGGTAATGAAATTGATTACGAAGCAGTC
ATTGAACTGATTATTTATGATATTCGAAATGCTAAAATAGGAAATTATTGTTTTGATATT
TTTAAAGATATGACTGAGGAATTAGCAAATGACGCTAACAATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
885
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1260 [new locus tag: SACOL_RS06435 ]
- symbol: RbgA
- description: ribosomal biogenesis GTPase
- length: 294
- theoretical pI: 9.6036
- theoretical MW: 33380.5
- GRAVY: -0.35034
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 364.7)and 16 moreProtein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 72.5)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 54.7)Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 52.5)Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 49.3)Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 43.3)Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 39.4)Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 37)Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 28.5)Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 25.1)Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 23.8)Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 23)Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 21.4)Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)Protein fate Protein and peptide secretion and trafficking signal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 13.1)Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 12.8)
- TheSEED :
- 50S ribosomal subunit maturation GTPase RbgA (B. subtilis YlqF)
- PFAM: P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 76.2)and 15 moreFeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 41.5)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 32.3)Dynamin_N; Dynamin family (PF00350; HMM-score: 20.2)Arf; ADP-ribosylation factor family (PF00025; HMM-score: 17.6)AAA_18; AAA domain (PF13238; HMM-score: 16.8)GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 15.4)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 14.3)AIG1; AIG1 family (PF04548; HMM-score: 14.3)Septin; Septin (PF00735; HMM-score: 13.4)Ras; Ras family (PF00071; HMM-score: 13.1)RNA_helicase; RNA helicase (PF00910; HMM-score: 12.8)Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 12.8)TniB; Bacterial TniB protein (PF05621; HMM-score: 12.6)SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 12.5)AAA_25; AAA domain (PF13481; HMM-score: 12.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9575
- Cytoplasmic Membrane Score: 0.0074
- Cell wall & surface Score: 0
- Extracellular Score: 0.0351
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002066
- TAT(Tat/SPI): 0.00021
- LIPO(Sec/SPII): 0.000572
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MVIQWYPGHMAKAKREVSEQLKKVDVVFELVDARIPYSSRNPMIDEVINQKPRVVILNKKDMSNLNEMSKWEQFFIDKGYYPVSVDAKHGKNLKKVEAAAIKATAEKFEREKAKGLKPRAIRAMIVGIPNVGKSTLINKLAKRSIAQTGNKPGVTKQQQWIKVGNALQLLDTPGILWPKFEDEEVGKKLSLTGAIKDSIVHLDEVAIYGLNFLIQNDLARLKSHYNIEVPEDAEIIAWFDAIGKKRGLIRRGNEIDYEAVIELIIYDIRNAKIGNYCFDIFKDMTEELANDANN
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 88 [4]
- interaction partners:
SACOL1637 (dnaK) molecular chaperone DnaK [5] (data from MRSA252) SACOL1199 (ftsZ) cell division protein FtsZ [5] (data from MRSA252) SACOL0593 (fusA) elongation factor G [5] (data from MRSA252) SACOL1513 (hup) DNA-binding protein HU [5] (data from MRSA252) SACOL1741 (icd) isocitrate dehydrogenase [5] (data from MRSA252) SACOL2623 (mqo2) malate:quinone oxidoreductase [5] (data from MRSA252) SACOL1102 (pdhA) pyruvate dehydrogenase complex E1 component subunit alpha [5] (data from MRSA252) SACOL1103 (pdhB) pyruvate dehydrogenase complex E1 component subunit beta [5] (data from MRSA252) SACOL1104 (pdhC) branched-chain alpha-keto acid dehydrogenase E2 [5] (data from MRSA252) SACOL1105 (pdhD) dihydrolipoamide dehydrogenase [5] (data from MRSA252) SACOL2128 (pdp) pyrimidine-nucleoside phosphorylase [5] (data from MRSA252) SACOL1746 (pfkA) 6-phosphofructokinase [5] (data from MRSA252) SACOL0204 (pflB) formate acetyltransferase [5] (data from MRSA252) SACOL1745 (pyk) pyruvate kinase [5] (data from MRSA252) SACOL0584 (rplA) 50S ribosomal protein L1 [5] (data from MRSA252) SACOL2236 (rplB) 50S ribosomal protein L2 [5] (data from MRSA252) SACOL2239 (rplC) 50S ribosomal protein L3 [5] (data from MRSA252) SACOL2238 (rplD) 50S ribosomal protein L4 [5] (data from MRSA252) SACOL2227 (rplE) 50S ribosomal protein L5 [5] (data from MRSA252) SACOL2224 (rplF) 50S ribosomal protein L6 [5] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [5] (data from MRSA252) SACOL0586 (rplL) 50S ribosomal protein L7/L12 [5] (data from MRSA252) SACOL2220 (rplO) 50S ribosomal protein L15 [5] (data from MRSA252) SACOL2232 (rplP) 50S ribosomal protein L16 [5] (data from MRSA252) SACOL2223 (rplR) 50S ribosomal protein L18 [5] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [5] (data from MRSA252) SACOL1725 (rplT) 50S ribosomal protein L20 [5] (data from MRSA252) SACOL1702 (rplU) 50S ribosomal protein L21 [5] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [5] (data from MRSA252) SACOL2237 (rplW) 50S ribosomal protein L23 [5] (data from MRSA252) SACOL1274 (rpsB) 30S ribosomal protein S2 [5] (data from MRSA252) SACOL2233 (rpsC) 30S ribosomal protein S3 [5] (data from MRSA252) SACOL1769 (rpsD) 30S ribosomal protein S4 [5] (data from MRSA252) SACOL2222 (rpsE) 30S ribosomal protein S5 [5] (data from MRSA252) SACOL2206 (rpsI) 30S ribosomal protein S9 [5] (data from MRSA252) SACOL2214 (rpsK) 30S ribosomal protein S11 [5] (data from MRSA252) SACOL0591 (rpsL) 30S ribosomal protein S12 [5] (data from MRSA252) SACOL2230 (rpsQ) 30S ribosomal protein S17 [5] (data from MRSA252) SACOL0816 (secA) preprotein translocase subunit SecA [5] (data from MRSA252) SACOL0095 (spa) immunoglobulin G binding protein A precursor [5] (data from MRSA252) SACOL1448 (sucB) dihydrolipoamide succinyltransferase [5] (data from MRSA252) SACOL0594 (tuf) elongation factor Tu [5] (data from MRSA252) SACOL0303 5'-nucleotidase [5] (data from MRSA252) SACOL0944 NADH dehydrogenase [5] (data from MRSA252) SACOL2173 alkaline shock protein 23 [5] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: 24.61 h [6]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 5.32 5.33 5.34 5.35 5.36 5.37 5.38 5.39 5.40 5.41 5.42 5.43 5.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)