From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1260 [new locus tag: SACOL_RS06435 ]
  • pan locus tag?: SAUPAN003535000
  • symbol: rbgA
  • pan gene symbol?: rbgA
  • synonym:
  • product: ribosomal biogenesis GTPase

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1260 [new locus tag: SACOL_RS06435 ]
  • symbol: rbgA
  • product: ribosomal biogenesis GTPase
  • replicon: chromosome
  • strand: +
  • coordinates: 1268908..1269792
  • length: 885
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGTTATTCAATGGTATCCAGGACATATGGCGAAAGCCAAAAGAGAAGTAAGTGAACAA
    TTAAAAAAAGTAGATGTAGTGTTTGAACTAGTAGATGCAAGAATTCCATATAGTTCAAGA
    AACCCTATGATAGATGAAGTTATTAACCAAAAACCACGTGTTGTTATATTAAATAAAAAA
    GATATGTCTAATTTAAATGAGATGTCAAAATGGGAACAATTTTTTATTGATAAAGGATAC
    TATCCTGTATCAGTGGATGCTAAGCACGGTAAAAATTTAAAGAAAGTGGAAGCTGCAGCA
    ATTAAGGCGACTGCTGAAAAATTTGAACGCGAAAAAGCGAAAGGACTTAAACCTAGAGCG
    ATAAGAGCAATGATCGTTGGAATTCCAAATGTTGGTAAATCCACATTAATAAATAAACTG
    GCAAAGCGTAGTATTGCGCAGACTGGTAATAAACCAGGTGTGACCAAACAACAACAATGG
    ATTAAAGTTGGTAATGCATTACAACTATTAGACACACCAGGGATACTTTGGCCTAAATTT
    GAAGATGAAGAAGTCGGTAAGAAGTTGAGTTTAACTGGTGCGATAAAAGATAGTATTGTG
    CACTTAGATGAAGTTGCCATCTATGGATTAAACTTTTTAATTCAAAATGATTTAGCGCGA
    TTAAAGTCACATTATAATATTGAAGTTCCTGAAGATGCAGAAATCATAGCGTGGTTTGAT
    GCGATAGGGAAAAAACGTGGCTTAATTCGACGTGGTAATGAAATTGATTACGAAGCAGTC
    ATTGAACTGATTATTTATGATATTCGAAATGCTAAAATAGGAAATTATTGTTTTGATATT
    TTTAAAGATATGACTGAGGAATTAGCAAATGACGCTAACAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL1260 [new locus tag: SACOL_RS06435 ]
  • symbol: RbgA
  • description: ribosomal biogenesis GTPase
  • length: 294
  • theoretical pI: 9.6036
  • theoretical MW: 33380.5
  • GRAVY: -0.35034

⊟Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 364.7)
    and 16 more
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 72.5)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 54.7)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 52.5)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 49.3)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 43.3)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 39.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 37)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 28.5)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 25.1)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 23.8)
    Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 23)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 21.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking signal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 13.1)
    Metabolism Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 12.8)
  • TheSEED  :
    • 50S ribosomal subunit maturation GTPase RbgA (B. subtilis YlqF)
    Protein Metabolism Protein biosynthesis Universal GTPases  50S ribosomal subunit maturation GTPase RbgA (B. subtilis YlqF)
  • PFAM:
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 72.3)
    and 14 more
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 40.6)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 32)
    AAA_18; AAA domain (PF13238; HMM-score: 21.5)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 18.2)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 18)
    ArgK; ArgK protein (PF03308; HMM-score: 14.8)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 14.6)
    AIG1; AIG1 family (PF04548; HMM-score: 14.2)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 13.6)
    Septin; Septin (PF00735; HMM-score: 13.3)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 13.1)
    Ras; Ras family (PF00071; HMM-score: 12.9)
    AAA_14; AAA domain (PF13173; HMM-score: 12.7)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 12.2)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002066
    • TAT(Tat/SPI): 0.00021
    • LIPO(Sec/SPII): 0.000572
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MVIQWYPGHMAKAKREVSEQLKKVDVVFELVDARIPYSSRNPMIDEVINQKPRVVILNKKDMSNLNEMSKWEQFFIDKGYYPVSVDAKHGKNLKKVEAAAIKATAEKFEREKAKGLKPRAIRAMIVGIPNVGKSTLINKLAKRSIAQTGNKPGVTKQQQWIKVGNALQLLDTPGILWPKFEDEEVGKKLSLTGAIKDSIVHLDEVAIYGLNFLIQNDLARLKSHYNIEVPEDAEIIAWFDAIGKKRGLIRRGNEIDYEAVIELIIYDIRNAKIGNYCFDIFKDMTEELANDANN

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 88 [4]
  • interaction partners:
    SACOL1637(dnaK)molecular chaperone DnaK  [5] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [5] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [5] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [5] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [5] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [5] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [5] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [5] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [5] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [5] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [5] (data from MRSA252)
    SACOL1746(pfkA)6-phosphofructokinase  [5] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [5] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [5] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [5] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [5] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [5] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [5] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [5] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [5] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [5] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [5] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [5] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [5] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [5] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [5] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [5] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [5] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [5] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [5] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [5] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [5] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [5] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [5] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [5] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [5] (data from MRSA252)
    SACOL0591(rpsL)30S ribosomal protein S12  [5] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [5] (data from MRSA252)
    SACOL0816(secA)preprotein translocase subunit SecA  [5] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [5] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [5] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [5] (data from MRSA252)
    SACOL03035'-nucleotidase  [5] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [5] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [5] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: 24.61 h [6]

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 5.32 5.33 5.34 5.35 5.36 5.37 5.38 5.39 5.40 5.41 5.42 5.43 5.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  6. ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SACOL1260&oldid=90783"