Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS12200 [old locus tag: SA2123 ]
- pan locus tag?: SAUPAN005819000
- symbol: SA_RS12200
- pan gene symbol?: hutR
- synonym:
- product: LysR family transcriptional regulator
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA_RS12200 [old locus tag: SA2123 ]
- symbol: SA_RS12200
- product: LysR family transcriptional regulator
- replicon: chromosome
- strand: +
- coordinates: 2388202..2389086
- length: 885
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGAAAATTATTCAGTTAGAATACTTCTTGGCTATCGTGAAATATAATAGTTTTACTAAA
GCTGCACAATTTTTACATATTAGCCAGCCATCTTTAACTGCTACGATTAAAAAAATGGAA
GCAGATTTAGGTTATGACTTATTTACACGTTCAACAAAAGACATCAAGATTACCGAAAAA
GGAATACAGTTTTATCGTTATGCGAGCGAATTAGTTCAACAATATCGATCCACGATGGAA
AAAATGTATGATTTAAGCGTTACATCAGAACCAAGGATAAAAATTGGGACTCTTGAATCT
ACGAATCAATGGATTGCGAATTTAATTCGAAAGCACCATTCCGACTACCCTGAACAGCAA
TATCGTTTATATGAAATACATGACAAACATCAATCTATAGAGCAATTACTGAATTTTAAT
ATTCATTTAGCTATAACAAATGAAAAAATAACCCACGAAGATATAAGATCCATTCCTTTA
TATGAGGAATCTTACATTTTATTAGCACCCAAGGAAACATTTAAAAATCAAAATTGGGTA
GATGTTGAAAATTTGCCACTCATATTACCAAACAAAAATTCTCAAGTGCGCAAACACTTA
GATGACTATTTTAATAGAAGAAATATTCGTCCAAATGTCGTTGTAGAAACAGATCGATTC
GAATCAGCAGTTGGATTTGTTCATCTCGGCTTAGGTTACGCTATCATTCCGAGATTTTAT
TACCAATCATTTCACACGTCTAATTTAGAATATAAAAAAATTCGTCCAAACTTAGGCCGA
AAAATTTATATCAATTACCATAAAAAACGCAAACACTCCGAACAAGTACATACATTCGTA
CAACAATGCCAAGATTATTTATATGGACTTTTAGAGGCTCTTTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
885
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS12200 [old locus tag: SA2123 ]
- symbol: SA_RS12200
- description: LysR family transcriptional regulator
- length: 294
- theoretical pI: 9.38669
- theoretical MW: 35017.8
- GRAVY: -0.546939
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions aminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 94.6)Energy metabolism Other pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)Regulatory functions DNA interactions pca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.3)and 6 moreCellular processes Toxin production and resistance transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)DNA metabolism DNA replication, recombination, and repair transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)Regulatory functions DNA interactions transcriptional regulator, ArgP family (TIGR03298; HMM-score: 56.5)putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 43.9)Regulatory functions DNA interactions D-serine deaminase transcriptional activator (TIGR02036; HMM-score: 26.9)homoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 13.4)
- TheSEED: see SA2123
- PFAM: PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 123.7)and 4 moreHTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 67.2)NUMOD1; NUMOD1 domain (PF07453; HMM-score: 15.1)MmeI_HD-like (CL0884) HsdM_N; HsdM N-terminal domain (PF12161; HMM-score: 15.1)CheY (CL0304) TadZ-like_ARD; TadZ-like, receiver domain (PF21194; HMM-score: 13.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- genes regulated by HutR*, TF important in Histidine utilization: see SA2123
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9196
- Cytoplasmic Membrane Score: 0.0688
- Cell wall & surface Score: 0.0008
- Extracellular Score: 0.0108
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.039007
- TAT(Tat/SPI): 0.004353
- LIPO(Sec/SPII): 0.002704
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKIIQLEYFLAIVKYNSFTKAAQFLHISQPSLTATIKKMEADLGYDLFTRSTKDIKITEKGIQFYRYASELVQQYRSTMEKMYDLSVTSEPRIKIGTLESTNQWIANLIRKHHSDYPEQQYRLYEIHDKHQSIEQLLNFNIHLAITNEKITHEDIRSIPLYEESYILLAPKETFKNQNWVDVENLPLILPNKNSQVRKHLDDYFNRRNIRPNVVVETDRFESAVGFVHLGLGYAIIPRFYYQSFHTSNLEYKKIRPNLGRKIYINYHKKRKHSEQVHTFVQQCQDYLYGLLEAL
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SA_RS09855 (gatA) glutamyl-tRNA(Gln) amidotransferase subunit A [1] (data from MRSA252) SA_RS01275 formate acetyltransferase [1] (data from MRSA252) SA_RS01365 L-lactate dehydrogenase [1] (data from MRSA252) SA_RS01960 acetyl-CoA acyltransferase [1] (data from MRSA252) SA_RS02640 ribose-phosphate pyrophosphokinase [1] (data from MRSA252) SA_RS02905 50S ribosomal protein L11 [1] (data from MRSA252) SA_RS02910 50S ribosomal protein L1 [1] (data from MRSA252) SA_RS02920 50S ribosomal protein L7/L12 [1] (data from MRSA252) SA_RS02950 30S ribosomal protein S7 [1] (data from MRSA252) SA_RS02955 elongation factor G [1] (data from MRSA252) SA_RS02960 elongation factor Tu [1] (data from MRSA252) SA_RS02985 UDP-glucose 4-epimerase [1] (data from MRSA252) SA_RS03645 hypothetical protein [1] (data from MRSA252) SA_RS03910 ribonucleotide-diphosphate reductase subunit alpha [1] (data from MRSA252) SA_RS04025 preprotein translocase subunit SecA [1] (data from MRSA252) SA_RS04140 aldehyde dehydrogenase [1] (data from MRSA252) SA_RS04160 enolase [1] (data from MRSA252) SA_RS04915 enoyl-ACP reductase [1] (data from MRSA252) SA_RS05350 pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) SA_RS05860 cell division protein FtsZ [1] (data from MRSA252) SA_RS05945 carbamoyl-phosphate synthase large chain [1] (data from MRSA252) SA_RS06140 50S ribosomal protein L19 [1] (data from MRSA252) SA_RS06225 30S ribosomal protein S2 [1] (data from MRSA252) SA_RS06235 elongation factor Ts [1] (data from MRSA252) SA_RS07060 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex [1] (data from MRSA252) SA_RS07205 serine/threonine dehydratase [1] (data from MRSA252) SA_RS07385 DNA-binding protein HU [1] (data from MRSA252) SA_RS07605 phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating) [1] (data from MRSA252) SA_RS07955 molecular chaperone DnaK [1] (data from MRSA252) SA_RS08295 50S ribosomal protein L21 [1] (data from MRSA252) SA_RS08545 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) SA_RS08560 pyruvate kinase [1] (data from MRSA252) SA_RS08625 universal stress protein UspA [1] (data from MRSA252) SA_RS08630 acetate kinase [1] (data from MRSA252) SA_RS10535 molecular chaperone GroEL [1] (data from MRSA252) SA_RS10945 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [1] (data from MRSA252) SA_RS11010 uracil phosphoribosyltransferase [1] (data from MRSA252) SA_RS11245 glutamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) SA_RS11430 Asp23/Gls24 family envelope stress response protein [1] (data from MRSA252) SA_RS11680 30S ribosomal protein S5 [1] (data from MRSA252) SA_RS11695 30S ribosomal protein S8 [1] (data from MRSA252) SA_RS11705 50S ribosomal protein L5 [1] (data from MRSA252) SA_RS11730 50S ribosomal protein L16 [1] (data from MRSA252) SA_RS11755 50S ribosomal protein L23 [1] (data from MRSA252) SA_RS13730 class I fructose-bisphosphate aldolase [1] (data from MRSA252) SA_RS13920 arginine deiminase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: HutR* see SA2123
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)