From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1271 [new locus tag: SACOL_RS06490 ]
  • pan locus tag?: SAUPAN003552000
  • symbol: hslU
  • pan gene symbol?: hslU
  • synonym: clpY
  • product: ATP-dependent protease ATP-binding subunit HslU

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1271 [new locus tag: SACOL_RS06490 ]
  • symbol: hslU
  • product: ATP-dependent protease ATP-binding subunit HslU
  • replicon: chromosome
  • strand: +
  • coordinates: 1282043..1283446
  • length: 1404
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGATACAGCTGGAATAAGATTAACTCCAAAAGAAATCGTATCTAAATTAAATGAATAC
    ATCGTTGGACAAAATGATGCTAAACGTAAAGTGGCAATTGCCCTACGTAATCGATACAGA
    AGAAGTTTATTAGATGAGGAATCAAAGCAAGAAATTTCACCTAAAAATATTTTGATGATT
    GGACCAACCGGCGTTGGTAAAACTGAAATTGCAAGAAGAATGGCCAAAGTTGTCGGCGCG
    CCATTTATAAAAGTAGAAGCTACTAAATTTACTGAGGTAGGTTATGTAGGACGAGATGTT
    GAAAGTATGGTTAGAGATCTTGTTGATGTTTCAGTAAGATTAGTCAAGGCGCAGAAAAAA
    TCATTGGTACAAGATGAAGCAACAGCTAAGGCCAATGAAAAACTTGTTAAGTTATTAGTT
    CCAAGTATGAAAAAGAAAGCGTCTCAAACGAATAATCCTTTAGAGTCACTTTTCGGAGGT
    GCAATTCCAAATTTCGGACAAAATAACGAAGATGAAGAAGAACCACCTACTGAGGAAATT
    AAAACAAAACGTTCTGAAATTAAGAGACAGCTAGAAGAAGGCAAACTTGAAAAAGAAAAG
    GTAAGAATTAAAGTCGAACAAGATCCTGGTGCTTTAGGTATGCTAGGTACAAATCAAAAT
    CAGCAAATGCAAGAGATGATGAATCAATTAATGCCTAAAAAGAAAGTTGAGCGAGAAGTT
    GCTGTTGAGACGGCAAGGAAAATCTTAGCTGATAGTTATGCGGATGAACTAATTGATCAA
    GAAAGCGCTAACCAAGAAGCGCTTGAATTAGCAGAACAAATGGGTATCATCTTTATAGAT
    GAAATCGACAAAGTTGCGACGAATAATCATAATAGTGGTCAAGATGTCTCAAGACAAGGT
    GTTCAAAGAGATATTTTACCTATACTTGAAGGTAGCGTTATTCAAACCAAATATGGTACT
    GTGAATACTGAACATATGCTGTTTATAGGTGCTGGAGCTTTCCATGTATCTAAGCCGAGT
    GACTTGATACCAGAATTGCAAGGTCGTTTTCCGATTAGAGTTGAACTTGATAGTTTATCG
    GTAGAAGATTTTGTAAGAATTTTGACAGAACCAAAATTGTCATTAATTAAACAATATGAA
    GCATTGCTTCAAACAGAAGAAGTTACTGTAAACTTTACCGATGAAGCAATTACTCGCTTA
    GCTGAGATTGCTTATCAAGTAAATCAAGATACAGACAACATTGGTGCACGTCGACTTCAT
    ACAATTTTAGAAAAGATGCTAGAAGATTTATCATTCGAAGCACCAAGTATGCCGAATGCA
    GTTGTAGATATTACCCCACAATATGTTGATGATAAATTAAAATCAATTTCAACAAATAAA
    GATTTAAGTGCATTTATTCTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1404

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1271 [new locus tag: SACOL_RS06490 ]
  • symbol: HslU
  • description: ATP-dependent protease ATP-binding subunit HslU
  • length: 467
  • theoretical pI: 4.95489
  • theoretical MW: 52314.5
  • GRAVY: -0.428266

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 621)
    and 18 more
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 206)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 206)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 46.4)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 36.4)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 30)
    Cellular processes Cellular processes Cell division ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 26.1)
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 22.1)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 21.4)
    Cellular processes Cellular processes Pathogenesis type VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 18.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 18.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 18)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides endopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 16.8)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 15.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 15.6)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 11.7)
    type IV conjugative transfer system coupling protein TraD (TIGR02759; HMM-score: 11.7)
  • TheSEED  :
    • ATP-dependent hsl protease ATP-binding subunit HslU
    Protein Metabolism Protein degradation Proteasome bacterial  ATP-dependent hsl protease ATP-binding subunit HslU
    and 1 more
    Protein Metabolism Protein degradation Proteolysis in bacteria, ATP-dependent  ATP-dependent hsl protease ATP-binding subunit HslU
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 110.5)
    and 30 more
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 64.8)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 31.3)
    MCM; MCM P-loop domain (PF00493; HMM-score: 26.6)
    AAA_lid (CL0671) ClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 24.1)
    P-loop_NTPase (CL0023) RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 21)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 20)
    AAA_28; AAA domain (PF13521; HMM-score: 19.6)
    AAA_22; AAA domain (PF13401; HMM-score: 18.8)
    TIP49; TIP49 P-loop domain (PF06068; HMM-score: 18.2)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 18.2)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 17.8)
    AAA_14; AAA domain (PF13173; HMM-score: 17.1)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.1)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 16.1)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 16.1)
    AAA_33; AAA domain (PF13671; HMM-score: 15.7)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 15.4)
    bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 15.3)
    AAA_18; AAA domain (PF13238; HMM-score: 14.6)
    AAA_19; AAA domain (PF13245; HMM-score: 14.4)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.8)
    AAA_25; AAA domain (PF13481; HMM-score: 13.5)
    IPT; Isopentenyl transferase (PF01745; HMM-score: 13.1)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 13.1)
    AAA_6; Hydrolytic ATP binding site of dynein motor region (PF12774; HMM-score: 12.8)
    AAA_24; AAA domain (PF13479; HMM-score: 12.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 12.5)
    NTPase_1; NTPase (PF03266; HMM-score: 12.4)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 10.6)
    sPC4_like (CL0609) DUF1818; Domain of unknown function (DUF1818) (PF08848; HMM-score: 8.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.95
    • Cytoplasmic Membrane Score: 0.05
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9863
    • Cytoplasmic Membrane Score: 0.0086
    • Cell wall & surface Score: 0.0003
    • Extracellular Score: 0.0048
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003554
    • TAT(Tat/SPI): 0.000221
    • LIPO(Sec/SPII): 0.000439
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MDTAGIRLTPKEIVSKLNEYIVGQNDAKRKVAIALRNRYRRSLLDEESKQEISPKNILMIGPTGVGKTEIARRMAKVVGAPFIKVEATKFTEVGYVGRDVESMVRDLVDVSVRLVKAQKKSLVQDEATAKANEKLVKLLVPSMKKKASQTNNPLESLFGGAIPNFGQNNEDEEEPPTEEIKTKRSEIKRQLEEGKLEKEKVRIKVEQDPGALGMLGTNQNQQMQEMMNQLMPKKKVEREVAVETARKILADSYADELIDQESANQEALELAEQMGIIFIDEIDKVATNNHNSGQDVSRQGVQRDILPILEGSVIQTKYGTVNTEHMLFIGAGAFHVSKPSDLIPELQGRFPIRVELDSLSVEDFVRILTEPKLSLIKQYEALLQTEEVTVNFTDEAITRLAEIAYQVNQDTDNIGARRLHTILEKMLEDLSFEAPSMPNAVVDITPQYVDDKLKSISTNKDLSAFIL

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 798 [4]
  • interaction partners:
    SACOL1800(dat)D-alanine aminotransferase  [5] (data from MRSA252)
    SACOL0002(dnaN)DNA polymerase III subunit beta  [5] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [5] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [5] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [5] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [5] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [5] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [5] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [5] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [5] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [5] (data from MRSA252)
    SACOL2092(murAA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [5] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [5] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [5] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [5] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [5] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [5] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [5] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [5] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [5] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [5] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [5] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [5] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [5] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [5] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [5] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [5] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [5] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [5] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [5] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [5] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [5] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [5] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [5] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [5] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [5] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [5] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [5] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [5] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [5] (data from MRSA252)
    SACOL1610(sodA2)superoxide dismutase  [5] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [5] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [5] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [5] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [5] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [5] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [5] (data from MRSA252)
    SACOL1759universal stress protein  [5] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [5] (data from MRSA252)
    SACOL2553pyruvate oxidase  [5] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 39.61 h [6]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 5.32 5.33 5.34 5.35 5.36 5.37 5.38 5.39 5.40 5.41 5.42 5.43 5.44 5.45 5.46 5.47 5.48 5.49 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]