From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1438 [new locus tag: SA_RS08110 ]
  • pan locus tag?: SAUPAN004206000
  • symbol: greA
  • pan gene symbol?: greA
  • synonym:
  • product: transcription elongation factor GreA

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1438 [new locus tag: SA_RS08110 ]
  • symbol: greA
  • product: transcription elongation factor GreA
  • replicon: chromosome
  • strand: -
  • coordinates: 1641180..1641656
  • length: 477
  • essential: yes DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGGAAAATCAAAAGCAATATCCAATGACTCAAGAAGGTTTTGAAAAATTAGAGCGTGAA
    CTTGAAGAATTAAAAACAGTTAAGCGTCCTGAAGTTGTAGAGAAAATTAAAGTTGCACGT
    TCATTTGGTGACTTATCAGAGAACTCTGAGTATGATGCAGCAAAAGATGAACAAGGATTC
    ATCGAACAAGATATTCAAAGAATTGAGCATATGTTAAGAAATGCATTAATCATTGAAGAT
    ACTGGAGATAACAACGTTGTTAAAATTGGTAAAACAGTAACGTTTGTAGAATTACCAGGT
    GATGAAGAGGAAAGTTATCAAATCGTTGGTTCAGCTGAATCAGATGCATTTAATGGTAAG
    ATTTCAAATGAATCACCAATGGCTAAAGCGTTAATTGGTAAAGGTTTAGATGATGAAGTT
    CGTGTTCCACTACCTAATGGTGGCGAAATGAACGTAAAAATTGTTAATATCCAATAA
    60
    120
    180
    240
    300
    360
    420
    477

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1438 [new locus tag: SA_RS08110 ]
  • symbol: GreA
  • description: transcription elongation factor GreA
  • length: 158
  • theoretical pI: 4.23889
  • theoretical MW: 17742.8
  • GRAVY: -0.652532

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Transcription Transcription factors transcription elongation factor GreA (TIGR01462; HMM-score: 187.3)
    and 1 more
    Genetic information processing Transcription Transcription factors transcription elongation factor GreB (TIGR01461; HMM-score: 96.8)
  • TheSEED  :
    • Transcription elongation factor GreA
    RNA Metabolism Transcription Transcription factors bacterial  Transcription elongation factor GreA
  • PFAM:
    no clan defined GreA_GreB_N; Transcription elongation factor, N-terminal (PF03449; HMM-score: 110.9)
    FKBP (CL0487) GreA_GreB; Transcription elongation factor, GreA/GreB, C-term (PF01272; HMM-score: 88.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9987
    • Cytoplasmic Membrane Score: 0.0001
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0012
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003649
    • TAT(Tat/SPI): 0.002256
    • LIPO(Sec/SPII): 0.000633
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MENQKQYPMTQEGFEKLERELEELKTVKRPEVVEKIKVARSFGDLSENSEYDAAKDEQGFIEQDIQRIEHMLRNALIIEDTGDNNVVKIGKTVTFVELPGDEEESYQIVGSAESDAFNGKISNESPMAKALIGKGLDDEVRVPLPNGGEMNVKIVNIQ

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA2427(arcB)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA1074(fabG)3-oxoacyl-ACP reductase  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA1394(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SA2204(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [1] (data from MRSA252)
    SA2030(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA0501(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA1930(rpoE)DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SA1116(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    SA1081(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    SA0354(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA1089(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0478glutamine amidotransferase subunit PdxT  [1] (data from MRSA252)
    SA0624hypothetical protein  [1] (data from MRSA252)
    SA1528hypothetical protein  [1] (data from MRSA252)
    SA1709hypothetical protein  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)