Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1438 [new locus tag: SA_RS08110 ]
- pan locus tag?: SAUPAN004206000
- symbol: greA
- pan gene symbol?: greA
- synonym:
- product: transcription elongation factor GreA
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1438 [new locus tag: SA_RS08110 ]
- symbol: greA
- product: transcription elongation factor GreA
- replicon: chromosome
- strand: -
- coordinates: 1641180..1641656
- length: 477
- essential: yes DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124280 NCBI
- RefSeq: NP_374723 NCBI
- BioCyc: see SA_RS08110
- MicrobesOnline: 103749 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGGAAAATCAAAAGCAATATCCAATGACTCAAGAAGGTTTTGAAAAATTAGAGCGTGAA
CTTGAAGAATTAAAAACAGTTAAGCGTCCTGAAGTTGTAGAGAAAATTAAAGTTGCACGT
TCATTTGGTGACTTATCAGAGAACTCTGAGTATGATGCAGCAAAAGATGAACAAGGATTC
ATCGAACAAGATATTCAAAGAATTGAGCATATGTTAAGAAATGCATTAATCATTGAAGAT
ACTGGAGATAACAACGTTGTTAAAATTGGTAAAACAGTAACGTTTGTAGAATTACCAGGT
GATGAAGAGGAAAGTTATCAAATCGTTGGTTCAGCTGAATCAGATGCATTTAATGGTAAG
ATTTCAAATGAATCACCAATGGCTAAAGCGTTAATTGGTAAAGGTTTAGATGATGAAGTT
CGTGTTCCACTACCTAATGGTGGCGAAATGAACGTAAAAATTGTTAATATCCAATAA60
120
180
240
300
360
420
477
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1438 [new locus tag: SA_RS08110 ]
- symbol: GreA
- description: transcription elongation factor GreA
- length: 158
- theoretical pI: 4.23889
- theoretical MW: 17742.8
- GRAVY: -0.652532
⊟Function[edit | edit source]
- TIGRFAM: Transcription Transcription factors transcription elongation factor GreA (TIGR01462; HMM-score: 187.3)and 1 moreTranscription Transcription factors transcription elongation factor GreB (TIGR01461; HMM-score: 96.8)
- TheSEED :
- Transcription elongation factor GreA
- PFAM: no clan defined GreA_GreB_N; Transcription elongation factor, N-terminal (PF03449; HMM-score: 110.9)FKBP (CL0487) GreA_GreB; Transcription elongation factor, GreA/GreB, C-term (PF01272; HMM-score: 88.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9987
- Cytoplasmic Membrane Score: 0.0001
- Cell wall & surface Score: 0
- Extracellular Score: 0.0012
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003649
- TAT(Tat/SPI): 0.002256
- LIPO(Sec/SPII): 0.000633
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MENQKQYPMTQEGFEKLERELEELKTVKRPEVVEKIKVARSFGDLSENSEYDAAKDEQGFIEQDIQRIEHMLRNALIIEDTGDNNVVKIGKTVTFVELPGDEEESYQIVGSAESDAFNGKISNESPMAKALIGKGLDDEVRVPLPNGGEMNVKIVNIQ
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA2427 (arcB) ornithine carbamoyltransferase [1] (data from MRSA252) SA1517 (citC) isocitrate dehydrogenase [1] (data from MRSA252) SA1409 (dnaK) molecular chaperone DnaK [1] (data from MRSA252) SA0731 (eno) phosphopyruvate hydratase [1] (data from MRSA252) SA1074 (fabG) 3-oxoacyl-ACP reductase [1] (data from MRSA252) SA1029 (ftsZ) cell division protein FtsZ [1] (data from MRSA252) SA1150 (glnA) glutamine-ammonia ligase [1] (data from MRSA252) SA1394 (glyS) glycyl-tRNA synthetase [1] (data from MRSA252) SA2204 (gpmA) phosphoglyceromutase [1] (data from MRSA252) SA1305 (hu) DNA-binding protein II [1] (data from MRSA252) SA1112 (infB) translation initiation factor IF-2 [1] (data from MRSA252) SA2334 (mvaS) 3-hydroxy-3-methylglutaryl-CoA synthase [1] (data from MRSA252) SA1244 (odhB) dihydrolipoamide succinyltransferase [1] (data from MRSA252) SA0943-1 (pdhA) pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) SA0218 (pflB) formate acetyltransferase [1] (data from MRSA252) SA1520 (pykA) pyruvate kinase [1] (data from MRSA252) SA0496 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SA2044 (rplB) 50S ribosomal protein L2 [1] (data from MRSA252) SA2047 (rplC) 50S ribosomal protein L3 [1] (data from MRSA252) SA2046 (rplD) 50S ribosomal protein L4 [1] (data from MRSA252) SA0495 (rplK) 50S ribosomal protein L11 [1] (data from MRSA252) SA2017 (rplM) 50S ribosomal protein L13 [1] (data from MRSA252) SA2029 (rplO) 50S ribosomal protein L15 [1] (data from MRSA252) SA1084 (rplS) 50S ribosomal protein L19 [1] (data from MRSA252) SA1502 (rplT) 50S ribosomal protein L20 [1] (data from MRSA252) SA1473 (rplU) 50S ribosomal protein L21 [1] (data from MRSA252) SA2045 (rplW) 50S ribosomal protein L23 [1] (data from MRSA252) SA0459 (rplY) 50S ribosomal protein L25 [1] (data from MRSA252) SA2030 (rpmD) 50S ribosomal protein L30 [1] (data from MRSA252) SA2023 (rpoA) DNA-directed RNA polymerase subunit alpha [1] (data from MRSA252) SA0500 (rpoB) DNA-directed RNA polymerase subunit beta [1] (data from MRSA252) SA0501 (rpoC) DNA-directed RNA polymerase subunit beta' [1] (data from MRSA252) SA1930 (rpoE) DNA-directed RNA polymerase subunit delta [1] (data from MRSA252) SA2041 (rpsC) 30S ribosomal protein S3 [1] (data from MRSA252) SA2031 (rpsE) 30S ribosomal protein S5 [1] (data from MRSA252) SA2034 (rpsH) 30S ribosomal protein S8 [1] (data from MRSA252) SA2016 (rpsI) 30S ribosomal protein S9 [1] (data from MRSA252) SA0503 (rpsL) 30S ribosomal protein S12 [1] (data from MRSA252) SA1116 (rpsO) 30S ribosomal protein S15 [1] (data from MRSA252) SA1081 (rpsP) 30S ribosomal protein S16 [1] (data from MRSA252) SA0354 (rpsR) 30S ribosomal protein S18 [1] (data from MRSA252) SA2043 (rpsS) 30S ribosomal protein S19 [1] (data from MRSA252) SA1089 (sucD) succinyl-CoA synthetase subunit alpha [1] (data from MRSA252) SA1499 (tig) trigger factor [1] (data from MRSA252) SA1100 (tsf) elongation factor Ts [1] (data from MRSA252) SA0478 glutamine amidotransferase subunit PdxT [1] (data from MRSA252) SA0624 hypothetical protein [1] (data from MRSA252) SA1528 hypothetical protein [1] (data from MRSA252) SA1709 hypothetical protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)