From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS08110 [old locus tag: SA1438 ]
  • symbol: SA_RS08110
  • product: transcription elongation factor GreA
  • replicon: chromosome
  • strand: -
  • coordinates: 1641180..1641656
  • length: 477
  • essential: yes DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (1641180..1641656) NCBI
  • BioCyc: SA_RS08110 BioCyc
  • MicrobesOnline: see SA1438

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGGAAAATCAAAAGCAATATCCAATGACTCAAGAAGGTTTTGAAAAATTAGAGCGTGAA
    CTTGAAGAATTAAAAACAGTTAAGCGTCCTGAAGTTGTAGAGAAAATTAAAGTTGCACGT
    TCATTTGGTGACTTATCAGAGAACTCTGAGTATGATGCAGCAAAAGATGAACAAGGATTC
    ATCGAACAAGATATTCAAAGAATTGAGCATATGTTAAGAAATGCATTAATCATTGAAGAT
    ACTGGAGATAACAACGTTGTTAAAATTGGTAAAACAGTAACGTTTGTAGAATTACCAGGT
    GATGAAGAGGAAAGTTATCAAATCGTTGGTTCAGCTGAATCAGATGCATTTAATGGTAAG
    ATTTCAAATGAATCACCAATGGCTAAAGCGTTAATTGGTAAAGGTTTAGATGATGAAGTT
    CGTGTTCCACTACCTAATGGTGGCGAAATGAACGTAAAAATTGTTAATATCCAATAA
    60
    120
    180
    240
    300
    360
    420
    477

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS08110 [old locus tag: SA1438 ]
  • symbol: SA_RS08110
  • description: transcription elongation factor GreA
  • length: 158
  • theoretical pI: 4.23889
  • theoretical MW: 17742.8
  • GRAVY: -0.652532

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Transcription Transcription factors transcription elongation factor GreA (TIGR01462; HMM-score: 187.3)
    and 1 more
    Genetic information processing Transcription Transcription factors transcription elongation factor GreB (TIGR01461; HMM-score: 96.8)
  • TheSEED: see SA1438
  • PFAM:
    no clan defined GreA_GreB_N; Transcription elongation factor, N-terminal (PF03449; HMM-score: 110.9)
    FKBP (CL0487) GreA_GreB; Transcription elongation factor, GreA/GreB, C-term (PF01272; HMM-score: 88.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9987
    • Cytoplasmic Membrane Score: 0.0001
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0012
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003649
    • TAT(Tat/SPI): 0.002256
    • LIPO(Sec/SPII): 0.000633
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MENQKQYPMTQEGFEKLERELEELKTVKRPEVVEKIKVARSFGDLSENSEYDAAKDEQGFIEQDIQRIEHMLRNALIIEDTGDNNVVKIGKTVTFVELPGDEEESYQIVGSAESDAFNGKISNESPMAKALIGKGLDDEVRVPLPNGGEMNVKIVNIQ

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS0202530S ribosomal protein S18  [1] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS02815pyridoxal 5'-phosphate synthase glutaminase subunit PdxT  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS02930DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA_RS02935DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA_RS0294530S ribosomal protein S12  [1] (data from MRSA252)
    SA_RS03575transcriptional regulator  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS06085beta-ketoacyl-ACP reductase  [1] (data from MRSA252)
    SA_RS0612530S ribosomal protein S16  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS06170succinyl-CoA ligase subunit alpha  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [1] (data from MRSA252)
    SA_RS0631530S ribosomal protein S15  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08600universal stress protein  [1] (data from MRSA252)
    SA_RS09810non-heme ferritin  [1] (data from MRSA252)
    SA_RS11090DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [1] (data from MRSA252)
    SA_RS11635DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1167550S ribosomal protein L30  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169530S ribosomal protein S8  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [1] (data from MRSA252)
    SA_RS126452,3-bisphosphoglycerate-dependent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Jump up to: 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]