Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_0317 [new locus tag: SAUSA300_RS01690 ]
- pan locus tag?: SAUPAN001241000
- symbol: SAUSA300_0317
- pan gene symbol?: nanR
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_0317 [new locus tag: SAUSA300_RS01690 ]
- symbol: SAUSA300_0317
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 368949..369749
- length: 801
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3915086 NCBI
- RefSeq: YP_493031 NCBI
- BioCyc: see SAUSA300_RS01690
- MicrobesOnline: 1291832 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781ATGAAATTTGAGAATCGTGTTCAACGTTATCAACATTTATTTACAAAAACTGATAAACGC
ATCGTCAATTATATAAGACAAAATGGTTATAGCGATGCCTTTTCAACGATTAACTCCTTA
GCCCATGCGATTGGTACATCACCAGCAACGATGACACGCTTTAGTCATAAGCTGGATTAT
GAGAATTTCCAAGATTTAAAATTTAATATTCAACAAGAAATGACAGAGACAGTTATTGAA
AATAGCCCAATTATTCAAAGAATTCATAAATATCATCAACAAATCATTCAACAAACTGGT
GAATTTATTGATAACGACATTATCCAAACCTTTATCGACAAACTTCAATCAAGTCGACAT
ATACTCTTTGCTGGACTAGGTAGCTCTGGTTTATCAGCGACTGAATTTTATTATCGTATG
ATTCGTATGGGGCTAAAAGGTAATGTTACTACCGATTCACATTTAATGAAAATATCGGCA
TCCCTACTATCTCATTCGGATATGTTTATTGCTATGTCAAATAGTGGTAATACTTCGGAA
TTAATTTCTGCAGCGGAAGTCGCCAAATCTCATGGTGCATATGTCGTTGCCATCACAAAT
TTTGAAGGTAGTAAACTTACAGATTGTGCAGATTTAGTACTTTTAACAACGGATCAATCG
CGTAATACCGACCATCAATTTATCAACACACAAATTGCGACACTCTTTTTAATCGATATC
GTGAGTTATCATTTATTAGAAAATACGAATCTGAGTCAAACTTATCAACATACTAAATCT
ATTATCCTAGACAACAAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
801
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_0317 [new locus tag: SAUSA300_RS01690 ]
- symbol: SAUSA300_0317
- description: hypothetical protein
- length: 266
- theoretical pI: 6.97071
- theoretical MW: 30258
- GRAVY: -0.282707
⊟Function[edit | edit source]
- TIGRFAM: 6-phospho 3-hexuloisomerase (TIGR03127; EC 5.3.-.-; HMM-score: 73.6)and 7 moreCell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan glutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)Central intermediary metabolism Amino sugars glutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)bifunctional phosphoglucose/phosphomannose isomerase (TIGR02128; EC 5.3.1.9; HMM-score: 33.7)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides phosphoheptose isomerase (TIGR00441; EC 5.3.1.28; HMM-score: 27.7)Energy metabolism Sugars sugar isomerase, KpsF/GutQ family (TIGR00393; HMM-score: 23.9)Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan N-acetylmuramic acid 6-phosphate etherase (TIGR00274; EC 4.2.1.126; HMM-score: 21.1)DNA metabolism DNA replication, recombination, and repair DNA topoisomerase IV, B subunit (TIGR01058; EC 5.99.1.-; HMM-score: 14.3)
- TheSEED :
- Sialic acid utilization regulator, RpiR family
- PFAM: SIS (CL0067) SIS; SIS domain (PF01380; HMM-score: 61)HTH (CL0123) HTH_6; Helix-turn-helix domain, rpiR family (PF01418; HMM-score: 50.5)and 6 moreSIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 37.7)HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 16.3)S4 (CL0492) TyrRSs_C; Tyrosyl-tRNA synthetase C-terminal domain (PF16714; HMM-score: 13.7)HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 13)Gal_mutarotase (CL0103) Glyco_transf_36; Glycosyltransferase family 36 (PF06165; HMM-score: 12.7)HTH (CL0123) HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 11.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effector: N-acetylmannosamine-6-phosphate
- genes regulated by NanR*, TF important in Sialic acid utilization, N-acetylglucosamine utilizationRegPrecisetranscription units transferred from N315 data RegPrecise
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9801
- Cytoplasmic Membrane Score: 0.0181
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0017
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.023801
- TAT(Tat/SPI): 0.008751
- LIPO(Sec/SPII): 0.003808
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKFENRVQRYQHLFTKTDKRIVNYIRQNGYSDAFSTINSLAHAIGTSPATMTRFSHKLDYENFQDLKFNIQQEMTETVIENSPIIQRIHKYHQQIIQQTGEFIDNDIIQTFIDKLQSSRHILFAGLGSSGLSATEFYYRMIRMGLKGNVTTDSHLMKISASLLSHSDMFIAMSNSGNTSELISAAEVAKSHGAYVVAITNFEGSKLTDCADLVLLTTDQSRNTDHQFINTQIATLFLIDIVSYHLLENTNLSQTYQHTKSIILDNK
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: NanR* (repression) regulon
NanR* (TF) important in Sialic acid utilization, N-acetylglucosamine utilization; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]