From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0259 [new locus tag: NWMN_RS01430 ]
  • pan locus tag?: SAUPAN001241000
  • symbol: NWMN_0259
  • pan gene symbol?: nanR
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_0259 [new locus tag: NWMN_RS01430 ]
  • symbol: NWMN_0259
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 315355..316155
  • length: 801
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAAATTTGAGAATCGTGTTCAACGTTATCAACATTTATTTACAAAAACTGATAAACGC
    ATCGTCAATTATATAAGACAAAATGGTTATAGCGATGCCTTTTCAACGATTAACTCCTTA
    GCCCATGCGATTGGTACATCACCAGCAACGATGACACGCTTTAGTCATAAGCTGGATTAT
    GAGAATTTCCAAGATTTAAAATTTAATATTCAACAAGAAATGACAGAGACAGTTATTGAA
    AATAGCCCAATTATTCAAAGAATTCATAAATATCATCAACAAATCATTCAACAAACTGGT
    GAATTTATTGATAACGACATTATCCAAGCCTTTATCGACAAACTTCAATCAAGTCGACAT
    ATACTCTTTGCTGGACTAGGTAGCTCTGGTTTATCAGCGACTGAATTTTATTATCGTATG
    ATTCGTATGGGGCTAAAAGGTAATGTTACTACCGATTCACATTTAATGAAAATATCGGCA
    TCCCTACTATCTCATTCGGATATGTTTATTGCTATGTCAAATAGTGGTAATACTTCGGAA
    TTAATTTCTGCAGCGGAAGTCGCCAAATCTCATGGTGCATATGTCGTTGCCATCACAAAT
    TTTGAAGGTAGTAAACTTACAGATTGTGCAGATTTAGTACTTTTAACAACGGATCAATCG
    CGTAATACCGACCATCAATTTATCAACACACAAATTGCGACACTCTTTTTAATCGATATC
    GTGAGTTATCATTTATTAGAAAATACGAATCTGAGTCAAACTTATCAACATACTAAATCT
    ATTATCCTAGACAACAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_0259 [new locus tag: NWMN_RS01430 ]
  • symbol: NWMN_0259
  • description: hypothetical protein
  • length: 266
  • theoretical pI: 6.97071
  • theoretical MW: 30227.9
  • GRAVY: -0.273308

Function[edit | edit source]

  • TIGRFAM:
    6-phospho 3-hexuloisomerase (TIGR03127; EC 5.3.-.-; HMM-score: 73.6)
    and 7 more
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan glutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)
    Metabolism Central intermediary metabolism Amino sugars glutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)
    bifunctional phosphoglucose/phosphomannose isomerase (TIGR02128; EC 5.3.1.9; HMM-score: 33.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides phosphoheptose isomerase (TIGR00441; EC 5.3.1.28; HMM-score: 27.7)
    Metabolism Energy metabolism Sugars sugar isomerase, KpsF/GutQ family (TIGR00393; HMM-score: 23.9)
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan N-acetylmuramic acid 6-phosphate etherase (TIGR00274; EC 4.2.1.126; HMM-score: 21.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA topoisomerase IV, B subunit (TIGR01058; EC 5.99.1.-; HMM-score: 14.9)
  • TheSEED  :
    • Sialic acid utilization regulator, RpiR family
    Cell Wall and Capsule Capsular and extracellular polysacchrides Sialic Acid Metabolism  Sialic acid utilization regulator, RpiR family
  • PFAM:
    SIS (CL0067) SIS; SIS domain (PF01380; HMM-score: 61)
    HTH (CL0123) HTH_6; Helix-turn-helix domain, rpiR family (PF01418; HMM-score: 50.4)
    and 6 more
    SIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 37.8)
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 16.4)
    S4 (CL0492) TyrRSs_C; Tyrosyl-tRNA synthetase C-terminal domain (PF16714; HMM-score: 13.7)
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 13)
    Gal_mutarotase (CL0103) Glyco_transf_36; Glycosyltransferase family 36 (PF06165; HMM-score: 12.7)
    HTH (CL0123) HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 11.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effector: N-acetylmannosamine-6-phosphate
  • genes regulated by NanR*, TF important in Sialic acid utilization, N-acetylglucosamine utilizationRegPrecise
    repression
    transcription units transferred from N315 data RegPrecise

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9808
    • Cytoplasmic Membrane Score: 0.0172
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0018
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.023801
    • TAT(Tat/SPI): 0.008751
    • LIPO(Sec/SPII): 0.003808
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKFENRVQRYQHLFTKTDKRIVNYIRQNGYSDAFSTINSLAHAIGTSPATMTRFSHKLDYENFQDLKFNIQQEMTETVIENSPIIQRIHKYHQQIIQQTGEFIDNDIIQAFIDKLQSSRHILFAGLGSSGLSATEFYYRMIRMGLKGNVTTDSHLMKISASLLSHSDMFIAMSNSGNTSELISAAEVAKSHGAYVVAITNFEGSKLTDCADLVLLTTDQSRNTDHQFINTQIATLFLIDIVSYHLLENTNLSQTYQHTKSIILDNK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: NanR* (repression) regulon
    NanR*(TF)important in Sialic acid utilization, N-acetylglucosamine utilization; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]