From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1735 [new locus tag: SACOL_RS08870 ]
  • pan locus tag?: SAUPAN004310000
  • symbol: coaE
  • pan gene symbol?: coaE
  • synonym:
  • product: dephospho-CoA kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1735 [new locus tag: SACOL_RS08870 ]
  • symbol: coaE
  • product: dephospho-CoA kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1766262..1766885
  • length: 624
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGCCGAAAGTTATTGGTCTAACAGGTGGAATCGCCTCAGGAAAATCAACAGTATCAGAA
    CTCTTATCCGTATTCGGTTTTAAAGTAGTAGATGCTGATAAAGCAGCCAGGGAAGCTGTT
    AAAAAGGGGAGTAAAGGTTTAGCTCAAGTACGAGAAGTCTTTGGTGATGAAGCAATTGAT
    GAAAATGGTGAGATGAATCGTCGTTATATGGGTGATCTAGTGTTTAATCATCCAGAAAAA
    CGCTTAGAATTAAATGCTATCATACATCCTATCGTGCGAGATATTATGGAAGAAGAAAAG
    CAAGAATATTTAAAACAAGGATATAATGTAATCATGGATATTCCATTATTATTTGAAAAT
    GAATTGGAAAATACAGTAGACGAAGTGTGGGTTGTATACACTTCTGAAAGTATACAAATG
    GATCGTTTAATGCAACGTAATAATTTGTCATTAGAAGATGCGAAAGCACGTGTCTATAGC
    CAAATTTCTATTGATAAAAAAAGCCGAATGGCCGATCATGTTATCGATAATTTAGGGGAT
    AAACTTGAATTAAAACAAAACCTTGAGAGATTGTTAGAAGAAGAAGGTTATATTGAAAAG
    CCGAATTACGGAGAAGAAGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    624

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1735 [new locus tag: SACOL_RS08870 ]
  • symbol: CoaE
  • description: dephospho-CoA kinase
  • length: 207
  • theoretical pI: 4.47247
  • theoretical MW: 23622.6
  • GRAVY: -0.518358

Function[edit | edit source]

  • reaction:
    EC 2.7.1.24?  ExPASy
    Dephospho-CoA kinase ATP + 3'-dephospho-CoA = ADP + CoA
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 195.3)
  • TheSEED  :
    • Dephospho-CoA kinase (EC 2.7.1.24)
    Cofactors, Vitamins, Prosthetic Groups, Pigments Coenzyme A Coenzyme A Biosynthesis  Dephospho-CoA kinase (EC 2.7.1.24)
  • PFAM:
    P-loop_NTPase (CL0023) CoaE; Dephospho-CoA kinase (PF01121; HMM-score: 196.6)
    and 6 more
    AAA_33; AAA domain (PF13671; HMM-score: 23)
    AAA_18; AAA domain (PF13238; HMM-score: 22.3)
    AAA_17; AAA domain (PF13207; HMM-score: 15.5)
    AAA_28; AAA domain (PF13521; HMM-score: 15.3)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 14.1)
    no clan defined Syntaphilin; Golgi-localised syntaxin-1-binding clamp (PF15290; HMM-score: 13.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9971
    • Cytoplasmic Membrane Score: 0.0008
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.002
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.042425
    • TAT(Tat/SPI): 0.003634
    • LIPO(Sec/SPII): 0.007542
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MPKVIGLTGGIASGKSTVSELLSVFGFKVVDADKAAREAVKKGSKGLAQVREVFGDEAIDENGEMNRRYMGDLVFNHPEKRLELNAIIHPIVRDIMEEEKQEYLKQGYNVIMDIPLLFENELENTVDEVWVVYTSESIQMDRLMQRNNLSLEDAKARVYSQISIDKKSRMADHVIDNLGDKLELKQNLERLLEEEGYIEKPNYGEED

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 521 [4]
  • interaction partners:
    SACOL0660(adhP)alcohol dehydrogenase  [5] (data from MRSA252)
    SACOL2218(adk)adenylate kinase  [5] (data from MRSA252)
    SACOL1478(ald1)alanine dehydrogenase  [5] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [5] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [5] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [5] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [5] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [5] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [5] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [5] (data from MRSA252)
    SACOL1665(greA)transcription elongation factor GreA  [5] (data from MRSA252)
    SACOL1368(kataA)catalase  [5] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [5] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [5] (data from MRSA252)
    SACOL0793(nrdF)ribonucleotide-diphosphate reductase subunit beta  [5] (data from MRSA252)
    SACOL0582(nusG)transcription antitermination protein  [5] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [5] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [5] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [5] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [5] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [5] (data from MRSA252)
    SACOL2120(rpoE)DNA-directed RNA polymerase subunit delta  [5] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [5] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [5] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [5] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [5] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [5] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [5] (data from MRSA252)
    SACOL0521hypothetical protein  [5] (data from MRSA252)
    SACOL1992hypothetical protein  [5] (data from MRSA252)
    SACOL2553pyruvate oxidase  [5] (data from MRSA252)
    SACOL2561hydroxymethylglutaryl-CoA synthase  [5] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 19.76 h [6]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]