Jump to navigation
Jump to search
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_1822 [new locus tag: NWMN_RS10465 ]
- pan locus tag?: SAUPAN004899000
- symbol: vraR
- pan gene symbol?: vraR
- synonym:
- product: DNA-binding response regulator VraR
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_1822 [new locus tag: NWMN_RS10465 ]
- symbol: vraR
- product: DNA-binding response regulator VraR
- replicon: chromosome
- strand: -
- coordinates: 2029206..2029835
- length: 630
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 5331107 NCBI
- RefSeq: YP_001332856 NCBI
- BioCyc:
- MicrobesOnline: 3707410 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGACGATTAAAGTATTGTTTGTGGATGATCATGAAATGGTACGTATAGGAATTTCAAGT
TATCTATCAACGCAAAGTGATATTGAAGTAGTTGGTGAAGGCGCTTCTGGTAAAGAAGCA
ATTGCCAAAGCCCATGAGTTGAAGCCAGATTTAATTTTAATGGATTTACTTATGGATGAC
ATGGATGGTGTAGAAGCGACGACTCAGATTAAAAAAGATTTACCGCAAATTAAAGTATTA
ATGTTAACTAGTTTTATTGAAGATAAAGAGGTATATCGTGCATTAGATGCAGGTGTCGAT
AGTTACATTTTAAAAACAACAAGTGCAAAAGATATCGCCGATGCAGTTCGTAAAACTTCT
AGAGGAGAATCTGTTTTTGAACCGGAAGTTTTAGTGAAAATGCGTAACCGTATGAAAAAG
CGCGCAGAGTTATATGAAATGCTTACAGAACGAGAAATGGAAATATTATTATTGATTGCG
AAAGGTTACTCAAATCAAGAAATTGCTAGTGCATCGCATATTACTATTAAAACGGTTAAG
ACACATGTGAGTAACATTTTAAGTAAGTTAGAAGTGCAAGATAGAACACAAGCTGTTATC
TATGCATTCCAACATAATTTAATTCAATAG60
120
180
240
300
360
420
480
540
600
630
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_1822 [new locus tag: NWMN_RS10465 ]
- symbol: VraR
- description: DNA-binding response regulator VraR
- length: 209
- theoretical pI: 5.39084
- theoretical MW: 23545.2
- GRAVY: -0.121531
⊟Function[edit | edit source]
- TIGRFAM: Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 72.3)and 15 moretranscriptional regulator EpsA (TIGR03020; HMM-score: 55.8)Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 36.5)Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)LuxR family transcriptional regulatory, chaperone HchA-associated (TIGR03541; HMM-score: 34)RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 26.4)Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 25.5)RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 21.1)Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 15.8)RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 13.4)
- TheSEED :
- Two component transcriptional regulator VraR
- PFAM: CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 93.3)and 14 moreHTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 71.1)Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 33.6)HTH_40; Helix-turn-helix domain (PF14493; HMM-score: 17.9)HTH_23; Homeodomain-like domain (PF13384; HMM-score: 16.6)UPF0122; Putative helix-turn-helix protein, YlxM / p13 like (PF04297; HMM-score: 15.6)Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 15.5)HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.3)no clan defined DUF3194; Protein of unknown function (DUF3194) (PF11419; HMM-score: 15)PDDEXK (CL0236) PDDEXK_10; PD-(D/E)XK nuclease superfamily (PF07788; HMM-score: 14)HTH (CL0123) HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 13.7)wHTH-PRTase_assc; wHTH-PRTase associated (PF24409; HMM-score: 13.6)no clan defined B12-binding; B12 binding domain (PF02310; HMM-score: 13)GT-A (CL0110) Rhamno_transf; Putative rhamnosyl transferase (PF11316; HMM-score: 12.9)HTH (CL0123) HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 12.9)
⊟Structure, modifications & cofactors[edit | edit source]
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9867
- Cytoplasmic Membrane Score: 0.0016
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0116
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006867
- TAT(Tat/SPI): 0.000297
- LIPO(Sec/SPII): 0.000634
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTIKVLFVDDHEMVRIGISSYLSTQSDIEVVGEGASGKEAIAKAHELKPDLILMDLLMDDMDGVEATTQIKKDLPQIKVLMLTSFIEDKEVYRALDAGVDSYILKTTSAKDIADAVRKTSRGESVFEPEVLVKMRNRMKKRAELYEMLTEREMEILLLIAKGYSNQEIASASHITIKTVKTHVSNILSKLEVQDRTQAVIYAFQHNLIQ
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: vraR < vraS < NWMN_1824 < NWMN_1825
⊟Regulation[edit | edit source]
- regulator: VraR (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Antoaneta Belcheva, Dasantila Golemi-Kotra
A close-up view of the VraSR two-component system. A mediator of Staphylococcus aureus response to cell wall damage.
J Biol Chem: 2008, 283(18);12354-64
[PubMed:18326495] [WorldCat.org] [DOI] (P p) - ↑ Pedro B Fernandes, Patricia Reed, João M Monteiro, Mariana G Pinho
Revisiting the Role of VraTSR in Staphylococcus aureus Response to Cell Wall-Targeting Antibiotics.
J Bacteriol: 2022, 204(8);e0016222
[PubMed:35862765] [WorldCat.org] [DOI] (I p) - ↑ 3.0 3.1 Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
Mol Microbiol: 2003, 49(3);807-21
[PubMed:12864861] [WorldCat.org] [DOI] (P p) - ↑ 4.0 4.1 Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)