From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1825 [new locus tag: NWMN_RS10480 ]
  • pan locus tag?: SAUPAN004902000
  • symbol: NWMN_1825
  • pan gene symbol?: vraU
  • synonym:
  • product: hypothetical protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1825 [new locus tag: NWMN_RS10480 ]
  • symbol: NWMN_1825
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2031581..2031967
  • length: 387
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAACTATGTTGAACGTTATATTGAACAGTTTTTGAGAGCAACAGTAAGAAATAATATC
    AAGCACTACCTTTTAATGCTAGATGAAAAAATGAAAAATTTAGATGATTATATGCGTTAT
    TTAATTACTAAAAAAGAACAACTTAGCAAGTTAATTGACAGTCTAATGCTAACATTAGAA
    AATAAATATATTGATATTGCTGAAGCATTTCAAATTCAATGTGCAAGAGAAATCAATAAT
    CAAGAAATTGAAAATATTAAATCAGAGTTGAATAAAGTTGAAGCATATTATGCACAAATT
    GAAACTCAAATTCAACAAACTTCAACTGAAAAAATAGCAACAGAAAAAACATCGTATCTA
    ATAAATTATATGAACGCTGTGGCATAG
    60
    120
    180
    240
    300
    360
    387


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: NWMN_1825 [new locus tag: NWMN_RS10480 ]
  • symbol: NWMN_1825
  • description: hypothetical protein
  • length: 128
  • theoretical pI: 4.98573
  • theoretical MW: 15289.5
  • GRAVY: -0.490625

⊟Function[edit | edit source]

  • TIGRFAM:
    two transmembrane protein (TIGR04527; HMM-score: 15.6)
    flagellar export protein FliJ (TIGR02473; HMM-score: 12.9)
    and 1 more
    Genetic information processing Protein fate Protein folding and stabilization prefoldin, alpha subunit (TIGR00293; HMM-score: 11.9)
  • TheSEED  :
    • Uncharacterized protein SAV1887
  • PFAM:
    no clan defined DUF5660; Domain of unknown function (DUF5660) (PF18904; HMM-score: 19.7)
    and 12 more
    DUF6617; Family of unknown function (DUF6617) (PF20322; HMM-score: 15.2)
    DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 14.9)
    Fusion_gly (CL0595) Baculo_F; Baculovirus F protein (PF12259; HMM-score: 14)
    GADPH_aa-bio_dh (CL0139) DAPDH_C; Diaminopimelic acid dehydrogenase C-terminal domain (PF16654; HMM-score: 13.8)
    no clan defined DUF1978; Domain of unknown function (DUF1978) (PF09321; HMM-score: 13.1)
    tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 12.8)
    no clan defined ApoO; Apolipoprotein O (PF09769; HMM-score: 12.2)
    Med28; Mediator complex subunit 28 (PF11594; HMM-score: 11.5)
    SKA2; Spindle and kinetochore-associated protein 2 (PF16740; HMM-score: 11.3)
    DUF4795; Domain of unknown function (DUF4795) (PF16043; HMM-score: 10.9)
    Mer2; Mer2 (PF09074; HMM-score: 10.7)
    LAMB4; Laminin subunit beta-4-like domain (PF24999; HMM-score: 9.7)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0.2738
    • Cytoplasmic Membrane Score: 0.0278
    • Cell wall & surface Score: 0.0005
    • Extracellular Score: 0.6979
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000789
    • TAT(Tat/SPI): 0.000078
    • LIPO(Sec/SPII): 0.000162
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNYVERYIEQFLRATVRNNIKHYLLMLDEKMKNLDDYMRYLITKKEQLSKLIDSLMLTLENKYIDIAEAFQIQCAREINNQEIENIKSELNKVEAYYAQIETQIQQTSTEKIATEKTSYLINYMNAVA

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: VraR (activation) regulon
    VraR(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [1] [2]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  2. ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)