Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1703 [new locus tag: SA_RS09770 ]
- pan locus tag?: SAUPAN004902000
- symbol: SA1703
- pan gene symbol?: vraU
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1703 [new locus tag: SA_RS09770 ]
- symbol: SA1703
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 1949117..1949503
- length: 387
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124587 NCBI
- RefSeq: NP_374994 NCBI
- BioCyc: see SA_RS09770
- MicrobesOnline: 104020 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGAACTATGTTGAACGTTATATTGAACAGTTTTTGAGAGCAACAGTAAGAAATAATATC
AAGCACTACCTTTTAATGCTAGATGAAAAAATGAAAAATTTAGATGATTATATGCGTTAT
TTAATTACTAAAAAAGAACAACTTAGCAAGTTAATTGACAGTCTAATGCTAACATTAGAA
AATAAATATATTGATATTGCTGAAGCATTTCAAATTCAATGTGCAAGAGAAATCAATAAT
CAAGAAATTGAAAATATTAAATCAGAGTTGAATAAAGTTGAAGCATATTATGCACAAATT
GAAACTCAAATTCAACAAACTTCAACTGAAAAAATAGCAACAGAAAAAACATCGTATCTA
ATAAATTATATGAACGCTGTGGCATAG60
120
180
240
300
360
387
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1703 [new locus tag: SA_RS09770 ]
- symbol: SA1703
- description: hypothetical protein
- length: 128
- theoretical pI: 4.98573
- theoretical MW: 15289.5
- GRAVY: -0.490625
⊟Function[edit | edit source]
- TIGRFAM: two transmembrane protein (TIGR04527; HMM-score: 15.6)flagellar export protein FliJ (TIGR02473; HMM-score: 12.9)and 1 moreProtein fate Protein folding and stabilization prefoldin, alpha subunit (TIGR00293; HMM-score: 11.9)
- TheSEED :
- Uncharacterized protein SAV1887
- PFAM: no clan defined DUF5660; Domain of unknown function (DUF5660) (PF18904; HMM-score: 19.7)and 12 moreDUF6617; Family of unknown function (DUF6617) (PF20322; HMM-score: 15.2)DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 14.9)Fusion_gly (CL0595) Baculo_F; Baculovirus F protein (PF12259; HMM-score: 14)GADPH_aa-bio_dh (CL0139) DAPDH_C; Diaminopimelic acid dehydrogenase C-terminal domain (PF16654; HMM-score: 13.8)no clan defined DUF1978; Domain of unknown function (DUF1978) (PF09321; HMM-score: 13.1)tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 12.8)no clan defined ApoO; Apolipoprotein O (PF09769; HMM-score: 12.2)Med28; Mediator complex subunit 28 (PF11594; HMM-score: 11.5)SKA2; Spindle and kinetochore-associated protein 2 (PF16740; HMM-score: 11.3)DUF4795; Domain of unknown function (DUF4795) (PF16043; HMM-score: 10.9)Mer2; Mer2 (PF09074; HMM-score: 10.7)LAMB4; Laminin subunit beta-4-like domain (PF24999; HMM-score: 9.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0.2738
- Cytoplasmic Membrane Score: 0.0278
- Cell wall & surface Score: 0.0005
- Extracellular Score: 0.6979
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.000789
- TAT(Tat/SPI): 0.000078
- LIPO(Sec/SPII): 0.000162
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNYVERYIEQFLRATVRNNIKHYLLMLDEKMKNLDDYMRYLITKKEQLSKLIDSLMLTLENKYIDIAEAFQIQCAREINNQEIENIKSELNKVEAYYAQIETQIQQTSTEKIATEKTSYLINYMNAVA
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: vraR < vraS < SA1702 < SA1703
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
⊟Relevant publications[edit | edit source]
Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)